ID: 930895546

View in Genome Browser
Species Human (GRCh38)
Location 2:56441412-56441434
Sequence AGGTAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930895546_930895553 22 Left 930895546 2:56441412-56441434 CCCACAATCACTGTGCTCTACCT No data
Right 930895553 2:56441457-56441479 ATGACACACAGCCACTGCCAGGG No data
930895546_930895552 21 Left 930895546 2:56441412-56441434 CCCACAATCACTGTGCTCTACCT No data
Right 930895552 2:56441456-56441478 CATGACACACAGCCACTGCCAGG No data
930895546_930895554 23 Left 930895546 2:56441412-56441434 CCCACAATCACTGTGCTCTACCT No data
Right 930895554 2:56441458-56441480 TGACACACAGCCACTGCCAGGGG No data
930895546_930895556 28 Left 930895546 2:56441412-56441434 CCCACAATCACTGTGCTCTACCT No data
Right 930895556 2:56441463-56441485 CACAGCCACTGCCAGGGGATGGG No data
930895546_930895555 27 Left 930895546 2:56441412-56441434 CCCACAATCACTGTGCTCTACCT No data
Right 930895555 2:56441462-56441484 ACACAGCCACTGCCAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930895546 Original CRISPR AGGTAGAGCACAGTGATTGT GGG (reversed) Intergenic