ID: 930899022

View in Genome Browser
Species Human (GRCh38)
Location 2:56481182-56481204
Sequence GTGACTGTCTTTGTTAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930899017_930899022 24 Left 930899017 2:56481135-56481157 CCTCTCAATTTGTTATAAGCCCA No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data
930899021_930899022 -10 Left 930899021 2:56481169-56481191 CCACAGAGTCTGAGTGACTGTCT No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data
930899018_930899022 5 Left 930899018 2:56481154-56481176 CCCATTGATCAACCTCCACAGAG No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data
930899020_930899022 -7 Left 930899020 2:56481166-56481188 CCTCCACAGAGTCTGAGTGACTG No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data
930899016_930899022 25 Left 930899016 2:56481134-56481156 CCCTCTCAATTTGTTATAAGCCC No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data
930899019_930899022 4 Left 930899019 2:56481155-56481177 CCATTGATCAACCTCCACAGAGT No data
Right 930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930899022 Original CRISPR GTGACTGTCTTTGTTAGCTC TGG Intergenic
No off target data available for this crispr