ID: 930901932

View in Genome Browser
Species Human (GRCh38)
Location 2:56517730-56517752
Sequence GGTGTTATGAGAATAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930901932_930901937 17 Left 930901932 2:56517730-56517752 CCTCATTTTATTCTCATAACACC No data
Right 930901937 2:56517770-56517792 AAGCTTTTTCTGCTTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930901932 Original CRISPR GGTGTTATGAGAATAAAATG AGG (reversed) Intergenic
No off target data available for this crispr