ID: 930903215

View in Genome Browser
Species Human (GRCh38)
Location 2:56533264-56533286
Sequence CTTCCCACCCACAGTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930903215_930903219 -7 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903219 2:56533280-56533302 TGGGAAGACTGCTACACCTGGGG No data
930903215_930903220 -6 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903220 2:56533281-56533303 GGGAAGACTGCTACACCTGGGGG No data
930903215_930903217 -9 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903217 2:56533278-56533300 GGTGGGAAGACTGCTACACCTGG No data
930903215_930903222 -1 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903222 2:56533286-56533308 GACTGCTACACCTGGGGGTAGGG No data
930903215_930903225 14 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903225 2:56533301-56533323 GGGTAGGGAGGCCACATCTGCGG No data
930903215_930903223 2 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903223 2:56533289-56533311 TGCTACACCTGGGGGTAGGGAGG No data
930903215_930903218 -8 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903218 2:56533279-56533301 GTGGGAAGACTGCTACACCTGGG No data
930903215_930903221 -2 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903221 2:56533285-56533307 AGACTGCTACACCTGGGGGTAGG No data
930903215_930903226 15 Left 930903215 2:56533264-56533286 CCAATACCACTGTGGGTGGGAAG No data
Right 930903226 2:56533302-56533324 GGTAGGGAGGCCACATCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930903215 Original CRISPR CTTCCCACCCACAGTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr