ID: 930907398

View in Genome Browser
Species Human (GRCh38)
Location 2:56588517-56588539
Sequence CTGTGGAATAAGTGCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930907396_930907398 -10 Left 930907396 2:56588504-56588526 CCAAATTAATTGCCTGTGGAATA No data
Right 930907398 2:56588517-56588539 CTGTGGAATAAGTGCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930907398 Original CRISPR CTGTGGAATAAGTGCAACCA TGG Intergenic
No off target data available for this crispr