ID: 930910148

View in Genome Browser
Species Human (GRCh38)
Location 2:56620868-56620890
Sequence AGTTATCTGCAGAAGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930910148_930910152 16 Left 930910148 2:56620868-56620890 CCTGGCATCTTCTGCAGATAACT No data
Right 930910152 2:56620907-56620929 ATAGCTCTTCACCTGGTAATGGG No data
930910148_930910154 25 Left 930910148 2:56620868-56620890 CCTGGCATCTTCTGCAGATAACT No data
Right 930910154 2:56620916-56620938 CACCTGGTAATGGGATTTGGTGG No data
930910148_930910151 15 Left 930910148 2:56620868-56620890 CCTGGCATCTTCTGCAGATAACT No data
Right 930910151 2:56620906-56620928 GATAGCTCTTCACCTGGTAATGG No data
930910148_930910150 9 Left 930910148 2:56620868-56620890 CCTGGCATCTTCTGCAGATAACT No data
Right 930910150 2:56620900-56620922 TTGAGAGATAGCTCTTCACCTGG No data
930910148_930910153 22 Left 930910148 2:56620868-56620890 CCTGGCATCTTCTGCAGATAACT No data
Right 930910153 2:56620913-56620935 CTTCACCTGGTAATGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930910148 Original CRISPR AGTTATCTGCAGAAGATGCC AGG (reversed) Intergenic
No off target data available for this crispr