ID: 930910556

View in Genome Browser
Species Human (GRCh38)
Location 2:56624259-56624281
Sequence CTCTGGTGACTAAGTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930910556_930910560 10 Left 930910556 2:56624259-56624281 CCTCCATTACTTAGTCACCAGAG No data
Right 930910560 2:56624292-56624314 AGTTGATGAAACTCATGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930910556 Original CRISPR CTCTGGTGACTAAGTAATGG AGG (reversed) Intergenic
No off target data available for this crispr