ID: 930910941

View in Genome Browser
Species Human (GRCh38)
Location 2:56628898-56628920
Sequence AATTATAATCAGAGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930910939_930910941 30 Left 930910939 2:56628845-56628867 CCTAGATCAGTAATGTTTTCTGA No data
Right 930910941 2:56628898-56628920 AATTATAATCAGAGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930910941 Original CRISPR AATTATAATCAGAGTGTAGT GGG Intergenic
No off target data available for this crispr