ID: 930911845

View in Genome Browser
Species Human (GRCh38)
Location 2:56638316-56638338
Sequence CATTGAGACCAGGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930911838_930911845 6 Left 930911838 2:56638287-56638309 CCTGTTTTCTATCTATGTCATAC No data
Right 930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930911845 Original CRISPR CATTGAGACCAGGAGGAAGA AGG Intergenic
No off target data available for this crispr