ID: 930920754

View in Genome Browser
Species Human (GRCh38)
Location 2:56750744-56750766
Sequence GTCAGCAATGGTAATCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930920754_930920757 25 Left 930920754 2:56750744-56750766 CCAGCAAGATTACCATTGCTGAC No data
Right 930920757 2:56750792-56750814 TTGTGTTTTATCTTAACCACTGG No data
930920754_930920758 26 Left 930920754 2:56750744-56750766 CCAGCAAGATTACCATTGCTGAC No data
Right 930920758 2:56750793-56750815 TGTGTTTTATCTTAACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930920754 Original CRISPR GTCAGCAATGGTAATCTTGC TGG (reversed) Intergenic
No off target data available for this crispr