ID: 930928533

View in Genome Browser
Species Human (GRCh38)
Location 2:56851479-56851501
Sequence TGCATTGTTCTCTCACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930928530_930928533 -1 Left 930928530 2:56851457-56851479 CCTTCCTTGTGTGACAAAAGCAT No data
Right 930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG No data
930928529_930928533 3 Left 930928529 2:56851453-56851475 CCTGCCTTCCTTGTGTGACAAAA No data
Right 930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG No data
930928531_930928533 -5 Left 930928531 2:56851461-56851483 CCTTGTGTGACAAAAGCATGCAT No data
Right 930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930928533 Original CRISPR TGCATTGTTCTCTCACATAT GGG Intergenic
No off target data available for this crispr