ID: 930932049

View in Genome Browser
Species Human (GRCh38)
Location 2:56897298-56897320
Sequence ATAATTCAGAACTTCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930932046_930932049 23 Left 930932046 2:56897252-56897274 CCAGCAAAATAGTCTACTCAGAA No data
Right 930932049 2:56897298-56897320 ATAATTCAGAACTTCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930932049 Original CRISPR ATAATTCAGAACTTCTTTAT GGG Intergenic
No off target data available for this crispr