ID: 930935225

View in Genome Browser
Species Human (GRCh38)
Location 2:56941030-56941052
Sequence TAATAGGTATACATATTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930935220_930935225 10 Left 930935220 2:56940997-56941019 CCAGGTTTCTCTTTAAAAACATT No data
Right 930935225 2:56941030-56941052 TAATAGGTATACATATTTACGGG No data
930935219_930935225 11 Left 930935219 2:56940996-56941018 CCCAGGTTTCTCTTTAAAAACAT No data
Right 930935225 2:56941030-56941052 TAATAGGTATACATATTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930935225 Original CRISPR TAATAGGTATACATATTTAC GGG Intergenic
No off target data available for this crispr