ID: 930942952

View in Genome Browser
Species Human (GRCh38)
Location 2:57035689-57035711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 2, 1: 1, 2: 13, 3: 67, 4: 451}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930942946_930942952 -6 Left 930942946 2:57035672-57035694 CCCCTTTACCTCAAGCACTGCTG No data
Right 930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG 0: 2
1: 1
2: 13
3: 67
4: 451
930942947_930942952 -7 Left 930942947 2:57035673-57035695 CCCTTTACCTCAAGCACTGCTGT No data
Right 930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG 0: 2
1: 1
2: 13
3: 67
4: 451
930942945_930942952 14 Left 930942945 2:57035652-57035674 CCTATGACTTTCTTCTCTAGCCC No data
Right 930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG 0: 2
1: 1
2: 13
3: 67
4: 451
930942948_930942952 -8 Left 930942948 2:57035674-57035696 CCTTTACCTCAAGCACTGCTGTG No data
Right 930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG 0: 2
1: 1
2: 13
3: 67
4: 451
930942944_930942952 26 Left 930942944 2:57035640-57035662 CCTGAGATAAGGCCTATGACTTT No data
Right 930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG 0: 2
1: 1
2: 13
3: 67
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900265785 1:1756459-1756481 GAACTGTGCTGGAGAAACCAAGG + Intronic
900366292 1:2313226-2313248 CTCCTTTGCAGGAGGAGCCATGG - Intergenic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900655601 1:3755258-3755280 CTGCTGAGGTGGAGACACCAGGG + Intronic
901157511 1:7150378-7150400 CCGCTCTGATGGAGGAAGCAGGG - Intronic
901892585 1:12280282-12280304 CAGCTGTTCTGGAGTAACCCAGG + Intronic
901925724 1:12565002-12565024 CTGATGTCCGGGAGGGACCAGGG - Intergenic
903049355 1:20589298-20589320 CTGCTGGGCTGGGGGACCCTGGG - Intronic
903261966 1:22136380-22136402 CTGCTGGGCTGAGGGAACCTGGG + Intronic
903753566 1:25645354-25645376 GGGCTGTGCTGCAGGAACCCAGG + Intronic
903872452 1:26446256-26446278 CTGCTGAGCTGGAGAGAGCAAGG - Intronic
904007263 1:27369914-27369936 CTGCTTTGGAAGAGGAACCACGG - Intronic
904040558 1:27582037-27582059 CTGCTGGTCTGGCGGAATCAGGG - Intronic
904163052 1:28535389-28535411 TTGCCCTGCTGGAGGTACCAAGG - Intronic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
904838586 1:33355451-33355473 CTCCTTTGCTGGAGGAACACTGG + Intronic
905134350 1:35787018-35787040 CTCCTGTGAAGGAGGAACAACGG + Intergenic
905396147 1:37667967-37667989 CCCCTGTCCTGGAGGAGCCAGGG + Intergenic
905593515 1:39185871-39185893 CTGAAGTGCTGAAGGACCCAGGG + Intronic
906888976 1:49686320-49686342 TTACTGTGCTGGAGGAGCCGAGG - Intronic
907499063 1:54865259-54865281 CAGCTGGCCTGGAGGAGCCAGGG + Intronic
907554645 1:55333770-55333792 AGGCTTTGCTGGAGGAACCCAGG + Intergenic
908143152 1:61209035-61209057 CTGCTGTACTGGAGTAGCCCTGG + Intronic
910503234 1:87918705-87918727 CTGCTGTGCTTGAGACAGCATGG - Intergenic
910708463 1:90154718-90154740 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
913283059 1:117203751-117203773 GTGCTTTTCTGGAGGAATCAGGG + Intronic
913383468 1:118233939-118233961 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914932305 1:151946029-151946051 CTGATGTACTGCAGGAACCAAGG - Intergenic
917011673 1:170481412-170481434 CTGCTCTGCTGGAGGGACTGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917696619 1:177532347-177532369 CTGCTGTGCTGGAGTGGCCAAGG - Intergenic
917913590 1:179677739-179677761 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
918819690 1:189236781-189236803 CTGCTCTGATGGAGGTAGCAAGG + Intergenic
918852427 1:189709082-189709104 CTGCTGTCCTGGAGGAGCTGAGG - Intergenic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
921336614 1:214093183-214093205 CTGCTGTACTGGAGGGGCCAAGG - Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
922542051 1:226427163-226427185 CTTCTGTGCATGAGGGACCAGGG - Intergenic
923122318 1:231003213-231003235 CTGCTCTGGTGGAGGAGGCAGGG - Intergenic
923628888 1:235636589-235636611 TTGCCCTGCTGGAGGACCCATGG - Intronic
923683136 1:236135445-236135467 CTGCCTTGCTGGAAGAACTATGG + Intergenic
924909574 1:248496517-248496539 ATGCTGTGGTGGAGGGAGCAGGG + Intergenic
924914528 1:248551543-248551565 ATGCTGTGGTGGAGGGAGCAGGG - Intergenic
1063457265 10:6192725-6192747 CTGATCTGCTGGGGAAACCAAGG + Intronic
1064913264 10:20427059-20427081 CTGCTGTGATGGAGGTGCCAAGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1066415825 10:35220630-35220652 GTGCTTGGCTCGAGGAACCATGG + Intergenic
1066507074 10:36056608-36056630 CTGCCGTGTTGGAGGTAACATGG + Intergenic
1067751581 10:48975270-48975292 CTGCTTTGCTGCGGGCACCAGGG + Intronic
1068730638 10:60354008-60354030 ATGCTGTGCAGGAGGCAACACGG - Intronic
1068738084 10:60437441-60437463 CTGCAGTGCTGCAGGGGCCAGGG + Intronic
1069195818 10:65550026-65550048 CTGCTGTGGAGTAGGAATCAAGG - Intergenic
1069264733 10:66443522-66443544 CTGCTGTTCTGCAGCCACCACGG + Intronic
1069648173 10:70019942-70019964 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1070500588 10:77069377-77069399 CTGCTGAGCTGGAGGATCCCTGG + Intronic
1070720992 10:78757023-78757045 ATGCCGTGCTGGGGGAAACAGGG - Intergenic
1071453876 10:85826755-85826777 CTGCTGTGCTGGAGGAACTGAGG - Intronic
1071761339 10:88611019-88611041 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1072637742 10:97188272-97188294 GTTCTGGGGTGGAGGAACCAGGG - Intronic
1072727967 10:97826310-97826332 CTGCTGTGCTGGAGGCAATCAGG + Intergenic
1072769206 10:98123711-98123733 CTGCTGTGGTGGAGTTAGCAGGG + Intergenic
1072871704 10:99126752-99126774 CTGCTGTGGTGGAGGTGGCAGGG - Intronic
1072963972 10:99955515-99955537 CTGCTGTGCTGAGGGAGGCAGGG + Exonic
1073755442 10:106576185-106576207 CTGCTGTGCAGGATGCAGCAAGG + Exonic
1074323102 10:112421679-112421701 CTGCTGGGCAGGAGGTGCCATGG + Intronic
1074475456 10:113769834-113769856 CTGATGTGCTGGAAGGGCCAAGG - Exonic
1075648473 10:124111881-124111903 CTGCTGTCTTGGAGACACCATGG - Intergenic
1075947780 10:126453240-126453262 CTGCTGTGCTAGATGCAGCAGGG + Intronic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1076629699 10:131844878-131844900 CTGCTGTCCTGGAGAAGCCTTGG + Intergenic
1077841611 11:5982023-5982045 CTACTGCACTGGAGGAGCCAAGG + Intergenic
1078485821 11:11722318-11722340 GTGCTGTGCTGGGGGGCCCATGG - Intergenic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1078636439 11:13054680-13054702 TTACTGTGCTGGAGCTACCAGGG + Intergenic
1079130578 11:17744730-17744752 GTGCTGTGCTGGAAGGGCCAGGG + Intronic
1079246059 11:18753173-18753195 CTGCTGTCCTGGGGGGACCTTGG - Intronic
1080511928 11:32983242-32983264 ATGCTATGCTGGAGGAACTGAGG - Intronic
1082665498 11:55971096-55971118 CTCCTGTGCTGGTGGACCCCCGG + Intergenic
1084007006 11:66328430-66328452 CTGCTGAGGCGGAGGACCCAGGG - Intergenic
1084191479 11:67501257-67501279 GTGCCTTGCTGGAGGTACCATGG + Intronic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1086824270 11:91475830-91475852 CTGCTGTGCTGGAGGGGCTGGGG - Intergenic
1087395359 11:97589824-97589846 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1087791773 11:102413513-102413535 CTGCCGTGCTGGAGGGACTTAGG - Intronic
1087817360 11:102674321-102674343 CTGCTATGCTTGAGGTGCCAAGG + Intergenic
1088833405 11:113557208-113557230 CTGCTCTGCTGGAGCAGTCACGG - Intergenic
1089518096 11:119046397-119046419 CTGGTGAGTTGGAGCAACCATGG - Exonic
1091251823 11:134150503-134150525 GAGCTGTGCTGGATGAAGCAAGG - Exonic
1091641752 12:2242358-2242380 CCTCCGTGCTGGAGGAACAATGG + Intronic
1091686548 12:2566707-2566729 GTGCTGTGCTGGAGACACCAAGG + Intronic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1093469130 12:19482294-19482316 CTGCTCTGCTGGAGGTGGCAGGG + Intronic
1093809586 12:23475092-23475114 CTGCTGTGCTGGAGGGGCTGAGG - Intergenic
1094523426 12:31216315-31216337 CTGATGTGCTGGAGGGACCAAGG - Intergenic
1095985440 12:47996127-47996149 CTGCTGTCCAGGAGAAAGCAAGG - Intronic
1096505595 12:52090505-52090527 CTGCTGTGGTCGGGGAACCATGG + Intergenic
1096809404 12:54160081-54160103 GTGCTGTGCTGAAGGATCCCAGG - Intergenic
1097603939 12:61730110-61730132 CTGCTGTGGTGGATGTAGCAAGG + Intronic
1099042040 12:77667902-77667924 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1100926794 12:99558022-99558044 CTGCTGTGGTGGAGGGGCCGAGG + Intronic
1100949502 12:99830263-99830285 TTTCTGTGCTGTAGGAACTATGG - Intronic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104428672 12:128698682-128698704 CTGCTCTGATGGAGCATCCAAGG - Intronic
1104456203 12:128914436-128914458 CTCCTGTGCTGAAGGATTCATGG + Intronic
1105036291 12:132924780-132924802 CTGCTGTGATGGAATAACAAGGG - Exonic
1105990373 13:25614889-25614911 CTGCTTTGTTGGAGGTAGCAAGG + Intronic
1106224208 13:27773018-27773040 CTGCTGTGGTGAAGAAACCTGGG - Intergenic
1107140437 13:36992943-36992965 CTGCTCTGCTGGAAGGATCAGGG - Intronic
1107157569 13:37187182-37187204 CTGCTTTGCTGGAGGAAGTATGG + Intergenic
1107699956 13:43037102-43037124 CTGCAGAGCGGGAGGCACCATGG - Intronic
1108134271 13:47338535-47338557 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1108700687 13:52941504-52941526 CTGCTGTTCTCTAGGAACCTGGG + Intergenic
1108831714 13:54487334-54487356 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1109934487 13:69264054-69264076 CTGCTGTGTTGAAGGGGCCAAGG + Intergenic
1111225661 13:85267227-85267249 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1112087047 13:96042127-96042149 CTGCTCTGCTGGAGGTGGCAGGG - Intronic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115404609 14:33000421-33000443 CTGATGTGCTGGATAAACCAGGG + Intronic
1115868819 14:37777980-37778002 CTGCTGTGCTGGAGGGGCCAAGG + Intronic
1116437606 14:44912332-44912354 CTGCCGTGCTGGGGGAGCCGGGG - Intergenic
1116580645 14:46637119-46637141 CTGCTGCACTTGAGGAACCTAGG + Intergenic
1117073765 14:52080108-52080130 CAGCTGTGGTGGAGAGACCAAGG - Intergenic
1118646481 14:67846000-67846022 CTTCTGTGCTGGAGGAGCCCAGG + Intronic
1120017100 14:79486489-79486511 CTGCTGTGGTGGGAAAACCATGG + Intronic
1120987535 14:90347294-90347316 CTGCTCAGCTGGAGGAACCAGGG - Intergenic
1121013423 14:90534761-90534783 CGGCTGTGCTGCAGGGACCTGGG + Exonic
1121060052 14:90898758-90898780 CTGCTTTGCAGCAGGAACTATGG - Intronic
1121107639 14:91291606-91291628 CAGCAGGGCTGGAGAAACCAGGG + Intronic
1121983113 14:98472113-98472135 CAGTTGCACTGGAGGAACCAAGG - Intergenic
1122987872 14:105220958-105220980 CTGCTGTGTGGGTGGAACCCAGG - Intronic
1123990279 15:25678299-25678321 CTGCTGTGTGGGAGGGACCTAGG - Exonic
1124505084 15:30265366-30265388 CTGCTCTGGTGGAGGCAACAGGG - Intergenic
1124738468 15:32273269-32273291 CTGCTCTGGTGGAGGCAACAGGG + Intergenic
1127337677 15:58005635-58005657 ATGTTATGCTGGATGAACCATGG + Intronic
1129516394 15:76160211-76160233 CTCCTGTCCTGGGGAAACCAAGG + Intronic
1129559781 15:76553606-76553628 CTGCTGTGCTGGAGGGGCCTAGG - Intronic
1129631731 15:77267466-77267488 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1130398796 15:83529925-83529947 CTGCTGTGCTGCTGAAACAAGGG - Intronic
1131092315 15:89632133-89632155 CTGATGTCCAGGAGGATCCAGGG - Intronic
1131399894 15:92116074-92116096 CTGCTGTGCTGCTCTAACCATGG + Intronic
1132005442 15:98222377-98222399 ATGCTGTGCTGAATGAAGCAAGG - Intergenic
1134612380 16:15619515-15619537 CTGAAGTGCTGGAGGAAGGAGGG - Intronic
1135883182 16:26279311-26279333 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1138223629 16:55274257-55274279 TGGCTCTGCTGGAGGAACAAAGG - Intergenic
1138315072 16:56062854-56062876 GTGCTGTGCTGGAGGCTCCCTGG - Intergenic
1139106824 16:63835984-63836006 CTGCTATGCTAGAGGAGCCAAGG - Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1140148183 16:72332862-72332884 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1141088223 16:81111786-81111808 CTGCTGTGCTGGGGGATGGATGG - Intergenic
1141142389 16:81505151-81505173 CTGCTGTCCTGGAGGCAGGACGG + Intronic
1141178886 16:81739057-81739079 GTGCTGTGCAGGAGGAAGCTGGG + Intergenic
1141305842 16:82863188-82863210 CAGCTGTCTTGGAGTAACCAAGG + Intronic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1141932052 16:87212059-87212081 TTGCTGTAATGGAAGAACCAAGG - Intronic
1142639949 17:1280021-1280043 CTCCTGTGCTGAAGGAAACTCGG - Exonic
1143385216 17:6525221-6525243 ATGCTATGAAGGAGGAACCAAGG + Intronic
1144137706 17:12314361-12314383 CTGCTGTGCTGAAGGGACTGAGG + Intergenic
1146515346 17:33484961-33484983 CTGCTCTGCAGGAGCAATCATGG + Intronic
1147304563 17:39554327-39554349 CTCCTATGCTGGCTGAACCAAGG + Intronic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1150880125 17:69015070-69015092 CTGCTATGCTGGAGGCAGAATGG - Intronic
1151122605 17:71808977-71808999 CTGCTGCACTGGAGGGGCCAAGG - Intergenic
1151141230 17:71993784-71993806 CTGCTGTGCTGAAGGGGCCAAGG - Intergenic
1151209331 17:72532647-72532669 CTGCTGAACTCGAGGAACCATGG + Intergenic
1152625684 17:81387001-81387023 CCGCTGTGCTGGAGGCAGCGGGG + Intergenic
1152631413 17:81412193-81412215 CTGCTGGCCTGGAGTGACCAGGG - Intronic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1153085322 18:1278995-1279017 TTGCTGCACTGGAGGAGCCAAGG - Intergenic
1153799381 18:8656054-8656076 CCTCTGGGCTGGGGGAACCAGGG + Intergenic
1154090070 18:11349778-11349800 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1154297930 18:13166280-13166302 CTGCTGTGGTGGAGGTGGCAGGG - Intergenic
1155367320 18:25061418-25061440 TTCCCGGGCTGGAGGAACCAAGG + Intergenic
1155400728 18:25436318-25436340 CTGCTGTGAAGGAAAAACCATGG - Intergenic
1155573767 18:27223548-27223570 CTGCTCTGATGGAGGTAGCAGGG + Intergenic
1159095814 18:63900479-63900501 CTTCTCTGCAGGAGGAATCATGG - Intronic
1160019669 18:75170613-75170635 CTGCTGAACTGAACGAACCACGG - Intergenic
1160865767 19:1255288-1255310 CTGATGTGCACGAGGGACCACGG - Intronic
1161105501 19:2441786-2441808 GAGCAGTGCTGGAGGAGCCAGGG + Intronic
1161206877 19:3046233-3046255 CTGCAGTGCTGGTGGAATTAGGG - Intronic
1161338190 19:3725931-3725953 CTGCAGTTCTGAAGGAGCCAGGG - Intronic
1161345437 19:3766825-3766847 CTGGTGTGCTGGAGGAACAGCGG + Intronic
1161610400 19:5238874-5238896 CTTCTCTGCGGGAGGGACCACGG - Intronic
1161770418 19:6227803-6227825 CTGCTGTGCAGGGGGAAGCTCGG + Intronic
1162029043 19:7909591-7909613 CTGCTGGGCTGGAGGAGCTGGGG - Intronic
1162440773 19:10690771-10690793 CTCCTGTGCTTGGGTAACCATGG + Exonic
1163758696 19:19121404-19121426 CTGGTGTGCAGGAGGAACCTGGG + Exonic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1166266940 19:41690382-41690404 GTGCTGTGATGGAGGAACACAGG - Intronic
1166500105 19:43333679-43333701 GTGCTGTGATGGAGGAACACAGG - Intergenic
1166723012 19:45008453-45008475 CATCTGTGCTGGATGAACCTGGG - Intronic
1167713028 19:51124041-51124063 CTCATGTTCTGGAGTAACCAGGG + Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925210784 2:2043742-2043764 CTGCTACCCTGGAGGAACCCAGG + Intronic
925306934 2:2854451-2854473 CTGATGTACTGAAGGAACAAAGG + Intergenic
925652270 2:6104008-6104030 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
925705591 2:6681817-6681839 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
927252583 2:21010937-21010959 CTGCTCAGCTGGAGTAAGCAGGG + Exonic
927519707 2:23691320-23691342 CTGCTTTGGTGGAGACACCAGGG + Intronic
927653428 2:24926520-24926542 ATACTGGGCAGGAGGAACCAGGG - Intergenic
927719900 2:25375943-25375965 TTGCAGTGCTGGAGGACCCCGGG - Intergenic
927981377 2:27377150-27377172 ATGCTGTGATGGGGGAAGCAGGG - Intronic
928029827 2:27768692-27768714 CTGCTGTGCTGGCAGACCCCTGG - Intergenic
928048145 2:27959562-27959584 CTGCTGTGTTGGAGTGACCTTGG + Intronic
928609244 2:32976234-32976256 CTGGTGTGCTGAAGGGGCCAAGG + Intronic
929191574 2:39145340-39145362 CAGCTGTGATGGAAGAGCCAAGG - Intergenic
929434564 2:41918629-41918651 CTGCTGTGCTGGAAGGGCGATGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930050425 2:47211484-47211506 CTGCTGTGCTGGAGCTCCCTGGG + Intergenic
930423007 2:51177255-51177277 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
930469640 2:51795778-51795800 CTGCTCTGCTGGAGGTAGCAGGG - Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
932266099 2:70368103-70368125 CTGCTCTGCAGGAGCAATCACGG + Intergenic
933173707 2:79154487-79154509 CTGCTGTGCTGGGGGTCCAAAGG + Intergenic
933289361 2:80420703-80420725 CTGCAGTGCTGGATTAACCAAGG - Intronic
933471789 2:82735401-82735423 CTGCTGTGCTGGTGGAGCTGAGG + Intergenic
933488579 2:82954790-82954812 TTCCTGTGCTGGTTGAACCATGG - Intergenic
933634939 2:84698563-84698585 CTGATGTGATGGAGGACACATGG - Intronic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
935273896 2:101459734-101459756 ATGCTGTGCTGGGAGAACCACGG + Intronic
936052430 2:109235023-109235045 CTACTGGGCTGAAGGGACCAGGG - Intronic
936701115 2:115012438-115012460 CTGCTTTGGTGGAGGCAGCAGGG - Intronic
936974197 2:118202979-118203001 ATGCTCTGCTGAAGGCACCAGGG - Intergenic
937798914 2:126058947-126058969 CTGCTCTGCTGGTGGTAGCAGGG + Intergenic
938199848 2:129363629-129363651 CTGCTGGGCTGGACAAACCTAGG - Intergenic
938216536 2:129522557-129522579 CTGCTCTGATGGAGGTAGCAGGG + Intergenic
938218890 2:129548746-129548768 ATGCTGGGCTGGAGGAAACCAGG - Intergenic
938398405 2:130967354-130967376 CTGATGGGCTGGAGGCTCCAGGG - Intronic
938564190 2:132503457-132503479 CTGCTTTGATGGAGGTAGCAGGG + Intronic
938996440 2:136683567-136683589 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
939712254 2:145536806-145536828 CTGCAGTCCTGGAGGAATGAAGG - Intergenic
940045872 2:149409291-149409313 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
940701709 2:157052830-157052852 TTGCTGTGTTGGAGGAAATATGG - Intergenic
942715416 2:178886147-178886169 CTGCTGACCTGGGAGAACCAGGG + Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943449309 2:188028387-188028409 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
943455685 2:188103789-188103811 CTGCTGTGCTGAAGGGGCCAAGG - Intergenic
943952297 2:194146644-194146666 CTGCTCTGCTGGAGGGGCCTAGG + Intergenic
943995241 2:194755180-194755202 CTTCTGAGCTGAAGTAACCAAGG + Intergenic
944599474 2:201288868-201288890 CTGCTGTGGTGAAGGAACGAAGG - Intronic
945068333 2:205966076-205966098 CTGCTGTGGTGGGGGAACTGTGG + Intergenic
945430311 2:209755766-209755788 CTGCTGTGCTGGAAGGTCCTAGG - Intergenic
945451692 2:210002181-210002203 CTTTTGAGCTGGAGGAACCCTGG - Intergenic
945734613 2:213584216-213584238 GTGGTGTGTTGGAGGAAGCATGG + Intronic
945734674 2:213584844-213584866 GTGGTGTGTTGGAGGAAGCATGG + Intronic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
947715250 2:232335963-232335985 CTGCAGTGCTGGGGGAGCCCAGG - Intronic
948372489 2:237498464-237498486 CTGATATGCTGGAGGAAGGAGGG + Intronic
948576779 2:238956896-238956918 CTGCTCTGGTGGAGGAAGCAGGG - Intergenic
948733768 2:239984803-239984825 CGGCTCTGCTGGTGGGACCAGGG - Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1169234328 20:3917461-3917483 CTGCTGAGGTGGGGGAGCCAAGG - Intronic
1170050948 20:12144814-12144836 CTGGTGGGCTGGAGGGGCCAAGG + Intergenic
1170086308 20:12535902-12535924 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1170650807 20:18239328-18239350 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1171433083 20:25098642-25098664 GTGCTTTTCTGGAGGAATCAGGG - Intergenic
1172132532 20:32665107-32665129 CTGCTGTGTGGGTAGAACCAGGG - Intergenic
1172148217 20:32772405-32772427 CTGCTGTGAGGGAGGGGCCAAGG + Intronic
1172487425 20:35306778-35306800 CTGCTGTGCTGTATGTTCCAGGG - Exonic
1172512064 20:35507788-35507810 CTGCTGTGCTGGTTGCACCTGGG - Exonic
1172774868 20:37401490-37401512 CTGCTGTGCTGGTTAAAGCAAGG + Intronic
1172872857 20:38146773-38146795 CTGCGGCGCTGGAAGAACCACGG - Exonic
1173484528 20:43430690-43430712 CTGCTGTGCAGGAGCAGTCACGG + Intergenic
1173620827 20:44434623-44434645 CTGATGAGGTGGAGGATCCAAGG - Intergenic
1174249416 20:49207331-49207353 CTTCTGTCCTGGAGGAGCCAGGG + Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1174794923 20:53514013-53514035 CTGCTGTGCTGGGGAATGCAGGG + Intergenic
1175049177 20:56137374-56137396 CAGGTGTTCTGGATGAACCAGGG - Intergenic
1175480797 20:59309319-59309341 CTACTCTGCTGGACGTACCAAGG - Intronic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1178732922 21:35121061-35121083 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1179460297 21:41530069-41530091 CTGCTGAGCTGTAGGACCAAAGG - Intronic
1180043860 21:45293908-45293930 CTGCTGTGCTGCAGGCCCCCCGG - Intergenic
1180252869 21:46601145-46601167 CTGCCGTGCTGCTGGAGCCAGGG + Intronic
1180699491 22:17773928-17773950 CTGCGGTGCTGGAAAGACCACGG + Exonic
1180877655 22:19182305-19182327 CCACTGTGGTGGGGGAACCAGGG + Intronic
1180896370 22:19336643-19336665 CTGCTGTGGTGGTGGTGCCAGGG - Intronic
1180903503 22:19392121-19392143 CTGCTGTGCTGTTGGCAGCAAGG - Exonic
1181048153 22:20226374-20226396 CTGCTGTGCTGGGGGACCTGGGG - Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182743809 22:32589103-32589125 CTGCTCTGCAGGAGGAGTCACGG + Intronic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1183690157 22:39383694-39383716 CCCCTGTGCTGGAGATACCAAGG + Exonic
1184987943 22:48148084-48148106 CTGCTCAGCTGTAGGAAGCAGGG + Intergenic
949737220 3:7187584-7187606 CTGCTCTGCAGGAGCAATCACGG - Intronic
949874782 3:8619033-8619055 CAGCTGTGTTGGATGGACCAAGG - Intergenic
950335172 3:12187567-12187589 CTTCTGTGGTGGAGCAGCCAGGG - Exonic
950599157 3:14016830-14016852 CTGCTGTGGTGGAGGTTTCAGGG + Intronic
952082927 3:29782285-29782307 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
955445710 3:59007620-59007642 CTGCTCTGGTGGAGGTAGCACGG - Intronic
955538262 3:59947703-59947725 CTGCTGTGCTGGAGGGGCATAGG + Intronic
956308627 3:67854206-67854228 CTGCTGTGGTGGTGCAACCCTGG + Intergenic
957040103 3:75329813-75329835 CTGCTGGGCTGGAGCTGCCAGGG + Intergenic
958537109 3:95418266-95418288 CTGCTGTCCTGGAGGGACTGAGG + Intergenic
958819062 3:98951927-98951949 CTGCTCTGATGGAGGTAGCAGGG + Intergenic
959877872 3:111407283-111407305 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
960012666 3:112850072-112850094 CTGCTGCACTGGAGGGGCCATGG - Intergenic
960688160 3:120314357-120314379 CTATTGTGCTGGAGGGGCCAAGG - Intergenic
961606033 3:128096182-128096204 CTGCAGTGCTGGGGGCACAAAGG - Intronic
962034497 3:131636793-131636815 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
964473991 3:157082473-157082495 GTGCTGTGCTGCAGGAGCAAAGG + Intergenic
965184613 3:165446865-165446887 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
966586587 3:181633248-181633270 CTGCTATGCTGGAATAACTATGG + Intergenic
967561979 3:190926769-190926791 CTGCTGTGCTGGAGGGGCTGAGG + Intergenic
967659617 3:192090828-192090850 CTGCTGTGCTGGAGGTGCTGAGG - Intergenic
967671242 3:192238190-192238212 CTGCTGTGCTGGAGGTGCTGAGG + Intronic
967724014 3:192844680-192844702 CTGATGGGCTGGAGGCTCCAGGG + Intronic
967725684 3:192860237-192860259 CTGCTGTGCTGGGGAGACCCTGG - Intronic
968952448 4:3702024-3702046 CAGCGGTGCAGGAGGAACCAGGG - Intergenic
969304833 4:6319641-6319663 CTGCTGTGCTGGAGGTCACCCGG - Intergenic
969731394 4:8959814-8959836 CAGCTGTGTTGAAGGACCCAAGG - Intergenic
970285392 4:14507674-14507696 CTGCTGTGCTGCAGGGCCCAAGG + Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
971681902 4:29710775-29710797 GAGCTGGGCTGGAGGATCCAAGG + Intergenic
971705916 4:30042597-30042619 CTGCTGTGATATAAGAACCAAGG - Intergenic
972806515 4:42533776-42533798 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
972933493 4:44103988-44104010 CTGCTGTGCTGGAAAGGCCAAGG + Intergenic
973920156 4:55675927-55675949 CTGCTCTGGTGGAGGTAACAGGG - Intergenic
974080845 4:57211056-57211078 CTGGTTTGCTGGAGGATCTAGGG + Intergenic
974127189 4:57710498-57710520 CTGCTCTGCTGGAGGTGGCAAGG - Intergenic
974472148 4:62332043-62332065 CTGCTCCACTGGAGGTACCAGGG - Intergenic
974543993 4:63276025-63276047 GTGCTGCAATGGAGGAACCAAGG - Intergenic
974650388 4:64747811-64747833 CTGCTGTGCTAGAGGATCTTAGG + Intergenic
974993574 4:69125074-69125096 AGGCTGTGCTGGAGGCAGCAGGG - Intronic
975614092 4:76229722-76229744 CTGCTCTGATGGAGGTATCAGGG + Intronic
975899147 4:79129511-79129533 CTGCTGTGCTGGAGGGGCTGAGG + Intergenic
975909939 4:79255773-79255795 CTGCTCTGCAGGAGCAGCCATGG - Intronic
976887903 4:90008149-90008171 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
976918203 4:90404618-90404640 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
977710340 4:100117203-100117225 CTAGTGCCCTGGAGGAACCAAGG + Intergenic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
977971455 4:103218363-103218385 GTGGTGTGCTGGAGGTACCAGGG - Intergenic
978241398 4:106520983-106521005 CTGCTGTGGTGGAGGGGTCAAGG + Intergenic
978916143 4:114127821-114127843 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
978924972 4:114231909-114231931 CTGCTCTGGTGGAGAAAGCAGGG - Intergenic
979129936 4:117031153-117031175 CTACTGAGCTAGAGAAACCAAGG + Intergenic
979856426 4:125638921-125638943 CTGCTGAGCTGCAGGCAACAAGG + Intergenic
980409903 4:132403666-132403688 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
980861008 4:138499730-138499752 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
984147339 4:176079312-176079334 CTGCAGTGCTGCAGTAAACATGG + Intronic
984190559 4:176600881-176600903 CTGCTTTGGTGGAGGTAGCAGGG + Intergenic
984675620 4:182544295-182544317 ATGCTGTGCTGGAGGGAGCTAGG - Intronic
985326389 4:188775825-188775847 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
986958658 5:13187742-13187764 CTGCTGTGTTCTAGGAACCTGGG - Intergenic
987018347 5:13844108-13844130 GTGCTGTGGTGGAGGAGACAGGG - Intronic
987093260 5:14525901-14525923 CTGCTGAGGTGGAAGAATCATGG + Intronic
987887773 5:23832583-23832605 CTACTGTGCTGGGAGGACCAAGG - Intergenic
988306248 5:29498353-29498375 CTGCTATGCTGGAAGAGCCGAGG + Intergenic
988640142 5:33032800-33032822 GTGCTGTGCTGGGAGAACCTGGG - Intergenic
989431493 5:41360744-41360766 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
989779459 5:45246956-45246978 CTGCTGTGCTGGAGGGGCTGAGG + Intergenic
991623042 5:68565953-68565975 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
992531355 5:77654465-77654487 CTGCTGTGCTGGGGGTAGCATGG - Intergenic
992898701 5:81270718-81270740 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
992965664 5:81997272-81997294 CTGCTGCACTGGAGGAGCCAAGG - Intronic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
993944191 5:94097968-94097990 CTGCTGTGCTGGAGGAGTTGAGG - Intronic
994248812 5:97512866-97512888 TTTCTTTGCTGGAGGAACGAGGG - Intergenic
994642997 5:102433624-102433646 ATGCTGTGCTGGAGGGGTCAAGG + Intronic
995488074 5:112659091-112659113 CTGCTGCACTGGAGGAGCCAAGG - Intergenic
995842963 5:116462109-116462131 CTTCTGTGTTGGGAGAACCAGGG + Intronic
996321509 5:122222382-122222404 CTGGGGTGCTGGAGGTACCTAGG - Intergenic
996385019 5:122901792-122901814 CTGCTGTGGAGGAGGACCCTAGG - Intronic
996567218 5:124892608-124892630 CTGCAGTGCTGGGGGACCCGGGG - Intergenic
998786270 5:145712112-145712134 CTGGTGTGCTGGAGCCATCAAGG + Intronic
999086153 5:148892160-148892182 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
999228988 5:150050408-150050430 CAGATGTGGGGGAGGAACCAGGG + Exonic
999330788 5:150672179-150672201 CTCCTGTGCTGGAGCAACTGTGG + Intronic
999566909 5:152874070-152874092 CTGCTATGCTGGAGGGGCCGAGG - Intergenic
999930911 5:156432153-156432175 CTGCTCTGATGGAGGTAGCAGGG + Intronic
1000569667 5:162896055-162896077 CTGCTATGCTGGAGTGGCCAAGG - Intergenic
1001001981 5:168016069-168016091 ATGTTATGATGGAGGAACCAAGG - Intronic
1001078927 5:168652610-168652632 CTGCTTTGCAGGTGGAACCTGGG + Intergenic
1001735435 5:173994688-173994710 CTGCTGTGCTTGCGAAGCCAAGG + Intronic
1001886364 5:175293935-175293957 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1002076265 5:176710325-176710347 CTGCTGTGGTGTAGAAACCTTGG - Intergenic
1002309591 5:178306519-178306541 CGGTTGTGCTGAAGGACCCATGG + Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1003495528 6:6660448-6660470 CTCCTGTGATGGAGAAACCATGG + Intergenic
1003914623 6:10775157-10775179 CTGCTCTGCTGGAGCAGTCATGG - Intronic
1004090468 6:12495042-12495064 CTGCTGTGCTGGAGGGGCTAAGG - Intergenic
1005244168 6:23862448-23862470 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1006515073 6:34541231-34541253 CTGCTGTGATGGGGCACCCATGG + Intronic
1006639596 6:35483110-35483132 CTGCTGTGTTCTAGGCACCAGGG - Intronic
1007878984 6:45140656-45140678 CTGCTGTGCTGGAGGTGGCAGGG - Intronic
1008295237 6:49767640-49767662 CTTCTTTGCTGTAGGAACAAAGG + Intergenic
1009248125 6:61264816-61264838 CTGCTGTGTTGGAGGAACTGAGG + Intergenic
1009266021 6:61555884-61555906 CTGCTGTGCTGGAGAGGCCAAGG + Intergenic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1009815265 6:68725180-68725202 CTGGTTTGTTGGAGGAACAATGG + Intronic
1010027865 6:71240307-71240329 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1010317274 6:74466143-74466165 CTGCTGTGCTGGAGGGGTCAAGG + Intergenic
1010681962 6:78808297-78808319 CTGCTGTACTGAAGGGGCCAAGG + Intergenic
1010771768 6:79840112-79840134 CTGCTGTGCTGCAGGAAATCAGG + Intergenic
1011320592 6:86088111-86088133 TTGCTGTGCTGCAGGGACCAAGG + Intergenic
1011375469 6:86681854-86681876 CTGCTCTGATGGAGGTAGCAGGG + Intergenic
1012204428 6:96442871-96442893 CTGCTGTGATGGAGGTGGCAGGG - Intergenic
1012273510 6:97243952-97243974 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
1012586794 6:100933072-100933094 CTGCTGTGCTGGAGGGACTGAGG + Intergenic
1013375259 6:109508670-109508692 TGGCTGTGCTGGAGGAGCAAAGG + Intronic
1013516663 6:110893329-110893351 CTTATGTGCTGGAGGGGCCAGGG - Intronic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1015896924 6:138026451-138026473 CTTCTGCGCTGGAGGAAGCAAGG + Intergenic
1016351701 6:143176191-143176213 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
1018812605 6:167308558-167308580 GTGGGGTGCAGGAGGAACCAGGG + Intronic
1019092092 6:169546354-169546376 CTGCTGGGCTGCAGGGACCTGGG + Intronic
1020090133 7:5334112-5334134 CTCCTGTGCTGGAGGATTTAAGG - Intronic
1020725927 7:11814545-11814567 CTGCAGTGCTTGATCAACCAAGG + Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1024334208 7:48188787-48188809 CAGCTGTGCTGATGGAAACATGG + Intronic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1026073571 7:67144789-67144811 CTGCTGTGCTGTAGGAAGTTTGG - Intronic
1026703314 7:72667391-72667413 CTGCTGTGCTGTAGGAAGTTTGG + Intronic
1027254885 7:76424946-76424968 CTGCTGCTCTGCAGGTACCATGG + Exonic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1028242904 7:88443205-88443227 CAGCTGTGCACCAGGAACCAGGG - Intergenic
1028261734 7:88674513-88674535 CTGCTCTGGTGGAGGCAGCAAGG - Intergenic
1028348005 7:89807599-89807621 CTGCTCTGGTGCAGGAAACAGGG + Intergenic
1028822630 7:95229918-95229940 CTGCTTTGATGGAGGTAGCAAGG - Intronic
1031311724 7:120207285-120207307 CTGCTGTGCTGGAGGGGTCAAGG - Intergenic
1031655414 7:124349211-124349233 CTGCTATGGTGGAGGCAGCAAGG + Intergenic
1032092820 7:128920110-128920132 CTGCTGGGCTGGGGGGACCGTGG + Intergenic
1032436479 7:131905132-131905154 CTGCTGTGCAGGAGCAGTCACGG + Intergenic
1033462703 7:141562048-141562070 CTGCTGTGGTGGAGGTGGCAGGG + Intronic
1035330532 7:158094206-158094228 CCCCTGTGCTGGGGGAACAAGGG - Intronic
1035339999 7:158153986-158154008 CAGCCATGCTGTAGGAACCATGG + Intronic
1035641088 8:1185771-1185793 CAGCAGTGCAGTAGGAACCAAGG + Intergenic
1035646118 8:1222446-1222468 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1038383806 8:27121740-27121762 CTGCTAGGTTGGAAGAACCAGGG + Intergenic
1038923629 8:32113473-32113495 CTGTCAGGCTGGAGGAACCAAGG - Intronic
1038990320 8:32860190-32860212 CTGCTGTGCTAGAGGCATCAAGG - Intergenic
1039465676 8:37783694-37783716 CTGCTTTGATGGAGCAACCCAGG + Intergenic
1040760281 8:50833208-50833230 CTGCTGTGCTGGAGGGGCTGAGG - Intergenic
1040871438 8:52103737-52103759 ATGCTGTGTTGGAGGAAATAGGG - Intergenic
1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG + Intergenic
1042163754 8:65924562-65924584 CAGCTGTGATGGAGGCACAAGGG - Intergenic
1042976625 8:74477652-74477674 CTGCTGTGTTGGAGGGGCCCAGG + Intronic
1045293503 8:100853156-100853178 CTGCTGTTCTGCAGCCACCACGG + Intergenic
1045405951 8:101867053-101867075 CTGGTGTGCTTGAGGAACGGTGG - Intronic
1045501109 8:102745122-102745144 CTGCTGGCCTGGAGCAGCCAGGG + Intergenic
1046249519 8:111611841-111611863 CTGCTTTGCTGCAGCAGCCAGGG - Intergenic
1047798059 8:128278065-128278087 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1047937450 8:129796777-129796799 CTGCTCTGGTGGAGGTAACAGGG + Intergenic
1048825240 8:138417598-138417620 CTGCTGTGTTGGAGGAGCCAAGG - Intronic
1049635774 8:143688368-143688390 CTGCTGTGCTGGAGGTGGGAGGG + Intronic
1050388139 9:5111644-5111666 CTGCTGGGCGGGAGGGACGAGGG - Intronic
1051102274 9:13535215-13535237 CTGCTGTGCTGGAGGGGCCGAGG + Intergenic
1051681324 9:19610936-19610958 CTGCTCTGTTGGAGGAATAAGGG + Intronic
1051684966 9:19648657-19648679 CTACTGGGCAGGAGGAACCGAGG + Intronic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052591178 9:30497718-30497740 TTGCTGGGCTGGAGGGACCAAGG + Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1055131404 9:72779070-72779092 CTGCTGTGCTGAAGGAGCTGAGG - Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055156368 9:73067347-73067369 CTGCTCTGATGGAGGTAGCAGGG - Intronic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1056642917 9:88386657-88386679 CTGCTGAGGTGGAGAAACCCAGG + Intergenic
1056673092 9:88648209-88648231 CTGCTCTGGTGAAGGAGCCATGG - Intergenic
1056948119 9:91018067-91018089 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1057475772 9:95399754-95399776 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1057638472 9:96794787-96794809 CTGCTGTGCTGGAGGGGCTGTGG + Intergenic
1058313424 9:103534106-103534128 CTGCTGCGCTGGAGGGGCCTAGG - Intergenic
1058861307 9:109119910-109119932 CGGCTGTGGCGGAGGAACGATGG - Exonic
1059337470 9:113578245-113578267 ACGCTGTGCTGGAGTGACCATGG + Intronic
1059374871 9:113874185-113874207 CTGGTGTGCAGCAGGCACCAAGG - Intergenic
1059420549 9:114188104-114188126 CTGCTGTGCCGGAGCAGTCACGG - Intronic
1060054148 9:120399501-120399523 ATGCTATGATGGAGGAATCAGGG + Intronic
1060068770 9:120528425-120528447 CTGCTGTGACAGAGGAACCATGG + Intronic
1060293345 9:122324740-122324762 CTCCTGTGCTGGAGGTAATAAGG + Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061937039 9:133863686-133863708 CAGCTATGCTGGAGGAGCCCTGG + Intronic
1062095012 9:134698629-134698651 CAGCTGTGCTGGAGTGACCAGGG + Intronic
1062214570 9:135382256-135382278 CTGCACTGCTGTAGGGACCAAGG - Intergenic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1186415287 X:9378299-9378321 ACGATGTGCTGGAGGATCCAGGG + Intergenic
1187016291 X:15332771-15332793 CTACTGTGCTAGAGGGACAAGGG + Intronic
1187109231 X:16279014-16279036 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1187644247 X:21329076-21329098 TTGCTGTGCTGGAGGGATCAAGG - Intergenic
1187722802 X:22169631-22169653 CAGCTATGCTGGAGGAACAGAGG + Intronic
1188886830 X:35561095-35561117 CTGCTACGCTGGAGGGAACAAGG - Intergenic
1189678401 X:43487542-43487564 CTGCTGTGCTGGAGGGGCCGAGG - Intergenic
1189926500 X:45960290-45960312 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1189946028 X:46179999-46180021 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1190056293 X:47182825-47182847 GTGCTGTGCTGGGGGGAACATGG + Intronic
1190284540 X:48953537-48953559 AGGCTTTGCTGGATGAACCAGGG - Intronic
1190322911 X:49188861-49188883 AGGCATTGCTGGAGGAACCAAGG + Exonic
1190973843 X:55379868-55379890 CTGCTGTGCTGGAAAGACCAAGG - Intergenic
1191026574 X:55920019-55920041 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1191033096 X:55996726-55996748 CTGCTCTGCTGGAGGAGCTGAGG + Intergenic
1191152903 X:57240390-57240412 CTGCTGTGCTGGATGGGCCAAGG + Intergenic
1191207795 X:57852938-57852960 CTGCTGTGCGGGAGGGACCTAGG + Intergenic
1191722702 X:64248100-64248122 CTGCTGTGCTGGAGGGGCTGAGG + Intergenic
1192919790 X:75694630-75694652 CTGCCGTGCTGGGGGAACTGAGG - Intergenic
1192934733 X:75848056-75848078 CTGCTGCACTGGAGGGACCATGG + Intergenic
1192996682 X:76520067-76520089 ATGCTGTGCTGGAGGGGCCAAGG + Intergenic
1193010471 X:76669811-76669833 CTGCAGTACTGGAGGGGCCAAGG - Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193449414 X:81647215-81647237 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1193578252 X:83230821-83230843 CTACTGCACTGGAGGAGCCAGGG + Intergenic
1193641005 X:84009442-84009464 ATGCTATGCTGGGAGAACCATGG - Intergenic
1193814796 X:86091458-86091480 CTGCTGTGCTGGAAGGGCCTAGG + Intergenic
1193994854 X:88352915-88352937 CTGCTCCGGTGGAGGAAGCAGGG - Intergenic
1194063630 X:89235364-89235386 CTGCTCTGCAGGAGGAGTCATGG + Intergenic
1194881767 X:99261101-99261123 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1195144613 X:102000518-102000540 CCGCTGTGCTGAAAGGACCAAGG - Intergenic
1195267905 X:103201311-103201333 CTGCTCTGCTGGGGCAATCATGG + Intergenic
1195656051 X:107332483-107332505 CTGCTGGGCTGCTGGAACTAGGG - Intergenic
1196024073 X:111021292-111021314 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1196586881 X:117440183-117440205 CTGCTGCACTAGAGGGACCAAGG - Intergenic
1196977857 X:121179896-121179918 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197140724 X:123114809-123114831 CTCCTGTGCTGGAGGTAATAAGG - Intergenic
1197377895 X:125705041-125705063 CTGCTGCCCTGGAGGGGCCAAGG + Intergenic
1198779849 X:140222451-140222473 CTGCTGCACTGGAGGGGCCAAGG - Intergenic
1198836895 X:140815334-140815356 CTGCTCTGATGGAGGAGGCAGGG + Intergenic
1198868284 X:141148638-141148660 CTTCTGTGCTAGAGGGACCAAGG + Intergenic
1198943234 X:141981925-141981947 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1199407967 X:147485210-147485232 CTGCTATGCTGGGGGGCCCAAGG + Intergenic
1199424256 X:147682411-147682433 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
1200107500 X:153723414-153723436 CTGATGCGCTGGCGGAAGCAGGG + Intronic
1200717804 Y:6569468-6569490 CTGCTCTGCAGGAGGAGTCATGG + Intergenic