ID: 930946756

View in Genome Browser
Species Human (GRCh38)
Location 2:57084776-57084798
Sequence CCCTCTTGGGTGCCGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946756_930946765 4 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946756_930946771 25 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG No data
930946756_930946768 12 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946756_930946763 -2 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946763 2:57084797-57084819 GGAGGCCTATGTCCACAGCCAGG No data
930946756_930946773 29 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946756_930946766 5 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946766 2:57084804-57084826 TATGTCCACAGCCAGGACTTGGG No data
930946756_930946770 24 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG No data
930946756_930946772 28 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946772 2:57084827-57084849 CTGCTGGAGCCATGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946756 Original CRISPR CCCTCTTGGGTGCCGGGAGC AGG (reversed) Intergenic