ID: 930946758

View in Genome Browser
Species Human (GRCh38)
Location 2:57084779-57084801
Sequence GCTCCCGGCACCCAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946750_930946758 20 Left 930946750 2:57084736-57084758 CCTTAGCTCGATAGCTGCAGCTG No data
Right 930946758 2:57084779-57084801 GCTCCCGGCACCCAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946758 Original CRISPR GCTCCCGGCACCCAAGAGGG AGG Intergenic
No off target data available for this crispr