ID: 930946760

View in Genome Browser
Species Human (GRCh38)
Location 2:57084783-57084805
Sequence TAGGCCTCCCTCTTGGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946760_930946765 -3 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946760_930946768 5 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946760_930946766 -2 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946766 2:57084804-57084826 TATGTCCACAGCCAGGACTTGGG No data
930946760_930946770 17 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG No data
930946760_930946763 -9 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946763 2:57084797-57084819 GGAGGCCTATGTCCACAGCCAGG No data
930946760_930946771 18 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG No data
930946760_930946772 21 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946772 2:57084827-57084849 CTGCTGGAGCCATGCCTGGGAGG No data
930946760_930946773 22 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946760_930946775 26 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946760_930946774 25 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946760 Original CRISPR TAGGCCTCCCTCTTGGGTGC CGG (reversed) Intergenic