ID: 930946762

View in Genome Browser
Species Human (GRCh38)
Location 2:57084790-57084812
Sequence GTGGACATAGGCCTCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946762_930946766 -9 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946766 2:57084804-57084826 TATGTCCACAGCCAGGACTTGGG No data
930946762_930946765 -10 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946762_930946774 18 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG No data
930946762_930946772 14 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946772 2:57084827-57084849 CTGCTGGAGCCATGCCTGGGAGG No data
930946762_930946773 15 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946762_930946775 19 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946762_930946768 -2 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946762_930946771 11 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG No data
930946762_930946770 10 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946762 Original CRISPR GTGGACATAGGCCTCCCTCT TGG (reversed) Intergenic
No off target data available for this crispr