ID: 930946763

View in Genome Browser
Species Human (GRCh38)
Location 2:57084797-57084819
Sequence GGAGGCCTATGTCCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946759_930946763 -8 Left 930946759 2:57084782-57084804 CCCGGCACCCAAGAGGGAGGCCT No data
Right 930946763 2:57084797-57084819 GGAGGCCTATGTCCACAGCCAGG No data
930946760_930946763 -9 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946763 2:57084797-57084819 GGAGGCCTATGTCCACAGCCAGG No data
930946756_930946763 -2 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946763 2:57084797-57084819 GGAGGCCTATGTCCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946763 Original CRISPR GGAGGCCTATGTCCACAGCC AGG Intergenic
No off target data available for this crispr