ID: 930946764

View in Genome Browser
Species Human (GRCh38)
Location 2:57084802-57084824
Sequence CAAGTCCTGGCTGTGGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946764_930946771 -1 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG No data
930946764_930946772 2 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946772 2:57084827-57084849 CTGCTGGAGCCATGCCTGGGAGG No data
930946764_930946770 -2 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG No data
930946764_930946775 7 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946764_930946773 3 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946764_930946774 6 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG No data
930946764_930946778 25 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946778 2:57084850-57084872 GTGGGACTGCTGTCTACTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946764 Original CRISPR CAAGTCCTGGCTGTGGACAT AGG (reversed) Intergenic