ID: 930946765

View in Genome Browser
Species Human (GRCh38)
Location 2:57084803-57084825
Sequence CTATGTCCACAGCCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946760_930946765 -3 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946759_930946765 -2 Left 930946759 2:57084782-57084804 CCCGGCACCCAAGAGGGAGGCCT No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946756_930946765 4 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946762_930946765 -10 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data
930946761_930946765 -9 Left 930946761 2:57084789-57084811 CCCAAGAGGGAGGCCTATGTCCA No data
Right 930946765 2:57084803-57084825 CTATGTCCACAGCCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946765 Original CRISPR CTATGTCCACAGCCAGGACT TGG Intergenic