ID: 930946767

View in Genome Browser
Species Human (GRCh38)
Location 2:57084809-57084831
Sequence AGCAGCCCAAGTCCTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946767_930946774 -1 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG No data
930946767_930946770 -9 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946770 2:57084823-57084845 TGGGCTGCTGGAGCCATGCCTGG No data
930946767_930946771 -8 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG No data
930946767_930946775 0 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946767_930946772 -5 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946772 2:57084827-57084849 CTGCTGGAGCCATGCCTGGGAGG No data
930946767_930946773 -4 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946767_930946778 18 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946778 2:57084850-57084872 GTGGGACTGCTGTCTACTCCCGG No data
930946767_930946779 28 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946779 2:57084860-57084882 TGTCTACTCCCGGCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946767 Original CRISPR AGCAGCCCAAGTCCTGGCTG TGG (reversed) Intergenic