ID: 930946768

View in Genome Browser
Species Human (GRCh38)
Location 2:57084811-57084833
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946761_930946768 -1 Left 930946761 2:57084789-57084811 CCCAAGAGGGAGGCCTATGTCCA No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946756_930946768 12 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946762_930946768 -2 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946760_930946768 5 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data
930946759_930946768 6 Left 930946759 2:57084782-57084804 CCCGGCACCCAAGAGGGAGGCCT No data
Right 930946768 2:57084811-57084833 ACAGCCAGGACTTGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr