ID: 930946769

View in Genome Browser
Species Human (GRCh38)
Location 2:57084815-57084837
Sequence GGCTCCAGCAGCCCAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946769_930946774 -7 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG No data
930946769_930946773 -10 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946769_930946781 30 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946781 2:57084868-57084890 CCCGGCTCCTGCAGGCTCTGTGG No data
930946769_930946775 -6 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946769_930946778 12 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946778 2:57084850-57084872 GTGGGACTGCTGTCTACTCCCGG No data
930946769_930946779 22 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946779 2:57084860-57084882 TGTCTACTCCCGGCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946769 Original CRISPR GGCTCCAGCAGCCCAAGTCC TGG (reversed) Intergenic