ID: 930946773

View in Genome Browser
Species Human (GRCh38)
Location 2:57084828-57084850
Sequence TGCTGGAGCCATGCCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946759_930946773 23 Left 930946759 2:57084782-57084804 CCCGGCACCCAAGAGGGAGGCCT No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946760_930946773 22 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946764_930946773 3 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946761_930946773 16 Left 930946761 2:57084789-57084811 CCCAAGAGGGAGGCCTATGTCCA No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946762_930946773 15 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946769_930946773 -10 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946767_930946773 -4 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data
930946756_930946773 29 Left 930946756 2:57084776-57084798 CCTGCTCCCGGCACCCAAGAGGG No data
Right 930946773 2:57084828-57084850 TGCTGGAGCCATGCCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946773 Original CRISPR TGCTGGAGCCATGCCTGGGA GGG Intergenic