ID: 930946775

View in Genome Browser
Species Human (GRCh38)
Location 2:57084832-57084854
Sequence GGAGCCATGCCTGGGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946762_930946775 19 Left 930946762 2:57084790-57084812 CCAAGAGGGAGGCCTATGTCCAC No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946761_930946775 20 Left 930946761 2:57084789-57084811 CCCAAGAGGGAGGCCTATGTCCA No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946767_930946775 0 Left 930946767 2:57084809-57084831 CCACAGCCAGGACTTGGGCTGCT No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946760_930946775 26 Left 930946760 2:57084783-57084805 CCGGCACCCAAGAGGGAGGCCTA No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946764_930946775 7 Left 930946764 2:57084802-57084824 CCTATGTCCACAGCCAGGACTTG No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946759_930946775 27 Left 930946759 2:57084782-57084804 CCCGGCACCCAAGAGGGAGGCCT No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data
930946769_930946775 -6 Left 930946769 2:57084815-57084837 CCAGGACTTGGGCTGCTGGAGCC No data
Right 930946775 2:57084832-57084854 GGAGCCATGCCTGGGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946775 Original CRISPR GGAGCCATGCCTGGGAGGGT GGG Intergenic
No off target data available for this crispr