ID: 930946902

View in Genome Browser
Species Human (GRCh38)
Location 2:57085299-57085321
Sequence GTCCAGAGCAACCACTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930946902_930946907 26 Left 930946902 2:57085299-57085321 CCATGACAGTGGTTGCTCTGGAC No data
Right 930946907 2:57085348-57085370 ACATCATTTATTGAGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930946902 Original CRISPR GTCCAGAGCAACCACTGTCA TGG (reversed) Intergenic
No off target data available for this crispr