ID: 930949639

View in Genome Browser
Species Human (GRCh38)
Location 2:57124393-57124415
Sequence TAGCTGAGGCAGCCAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930949639_930949646 24 Left 930949639 2:57124393-57124415 CCCTTCTCTGGCTGCCTCAGCTA No data
Right 930949646 2:57124440-57124462 TTGTAACACAGCTTCTCCCTTGG No data
930949639_930949643 -5 Left 930949639 2:57124393-57124415 CCCTTCTCTGGCTGCCTCAGCTA No data
Right 930949643 2:57124411-57124433 AGCTACACAGAGCTGCCACAGGG No data
930949639_930949642 -6 Left 930949639 2:57124393-57124415 CCCTTCTCTGGCTGCCTCAGCTA No data
Right 930949642 2:57124410-57124432 CAGCTACACAGAGCTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930949639 Original CRISPR TAGCTGAGGCAGCCAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr