ID: 930950626

View in Genome Browser
Species Human (GRCh38)
Location 2:57139812-57139834
Sequence TACACCTTCAATAAAATATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930950626_930950628 5 Left 930950626 2:57139812-57139834 CCGGATATTTTATTGAAGGTGTA No data
Right 930950628 2:57139840-57139862 TTGGTTTGCATTATTATTAAAGG No data
930950626_930950629 6 Left 930950626 2:57139812-57139834 CCGGATATTTTATTGAAGGTGTA No data
Right 930950629 2:57139841-57139863 TGGTTTGCATTATTATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930950626 Original CRISPR TACACCTTCAATAAAATATC CGG (reversed) Intergenic
No off target data available for this crispr