ID: 930950628

View in Genome Browser
Species Human (GRCh38)
Location 2:57139840-57139862
Sequence TTGGTTTGCATTATTATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930950626_930950628 5 Left 930950626 2:57139812-57139834 CCGGATATTTTATTGAAGGTGTA No data
Right 930950628 2:57139840-57139862 TTGGTTTGCATTATTATTAAAGG No data
930950624_930950628 15 Left 930950624 2:57139802-57139824 CCAAATACTTCCGGATATTTTAT No data
Right 930950628 2:57139840-57139862 TTGGTTTGCATTATTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930950628 Original CRISPR TTGGTTTGCATTATTATTAA AGG Intergenic
No off target data available for this crispr