ID: 930950629

View in Genome Browser
Species Human (GRCh38)
Location 2:57139841-57139863
Sequence TGGTTTGCATTATTATTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930950624_930950629 16 Left 930950624 2:57139802-57139824 CCAAATACTTCCGGATATTTTAT No data
Right 930950629 2:57139841-57139863 TGGTTTGCATTATTATTAAAGGG No data
930950626_930950629 6 Left 930950626 2:57139812-57139834 CCGGATATTTTATTGAAGGTGTA No data
Right 930950629 2:57139841-57139863 TGGTTTGCATTATTATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930950629 Original CRISPR TGGTTTGCATTATTATTAAA GGG Intergenic
No off target data available for this crispr