ID: 930950629 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:57139841-57139863 |
Sequence | TGGTTTGCATTATTATTAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
930950624_930950629 | 16 | Left | 930950624 | 2:57139802-57139824 | CCAAATACTTCCGGATATTTTAT | No data | ||
Right | 930950629 | 2:57139841-57139863 | TGGTTTGCATTATTATTAAAGGG | No data | ||||
930950626_930950629 | 6 | Left | 930950626 | 2:57139812-57139834 | CCGGATATTTTATTGAAGGTGTA | No data | ||
Right | 930950629 | 2:57139841-57139863 | TGGTTTGCATTATTATTAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
930950629 | Original CRISPR | TGGTTTGCATTATTATTAAA GGG | Intergenic | ||
No off target data available for this crispr |