ID: 930961349

View in Genome Browser
Species Human (GRCh38)
Location 2:57266133-57266155
Sequence CATGATTCCTTTTAAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930961349_930961356 24 Left 930961349 2:57266133-57266155 CCACAGGCTTAAAAGGAATCATG No data
Right 930961356 2:57266180-57266202 AATCATGGCAGAAAGTGAAGGGG 0: 77
1: 1003
2: 2141
3: 3862
4: 5637
930961349_930961355 23 Left 930961349 2:57266133-57266155 CCACAGGCTTAAAAGGAATCATG No data
Right 930961355 2:57266179-57266201 CAATCATGGCAGAAAGTGAAGGG 0: 100
1: 1396
2: 2682
3: 4834
4: 5607
930961349_930961354 22 Left 930961349 2:57266133-57266155 CCACAGGCTTAAAAGGAATCATG No data
Right 930961354 2:57266178-57266200 ACAATCATGGCAGAAAGTGAAGG 0: 73
1: 1028
2: 2214
3: 4145
4: 5009
930961349_930961353 9 Left 930961349 2:57266133-57266155 CCACAGGCTTAAAAGGAATCATG No data
Right 930961353 2:57266165-57266187 CCTCAGGAATCTTACAATCATGG 0: 49
1: 6287
2: 9091
3: 6794
4: 4254
930961349_930961351 -7 Left 930961349 2:57266133-57266155 CCACAGGCTTAAAAGGAATCATG No data
Right 930961351 2:57266149-57266171 AATCATGACTGAAAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930961349 Original CRISPR CATGATTCCTTTTAAGCCTG TGG (reversed) Intergenic
No off target data available for this crispr