ID: 930972686

View in Genome Browser
Species Human (GRCh38)
Location 2:57416300-57416322
Sequence ATCATTTGAGAAATAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930972686_930972689 14 Left 930972686 2:57416300-57416322 CCAGTATTTATTTCTCAAATGAT No data
Right 930972689 2:57416337-57416359 CAGTTTCTCCAGAGGTTATGAGG No data
930972686_930972691 28 Left 930972686 2:57416300-57416322 CCAGTATTTATTTCTCAAATGAT No data
Right 930972691 2:57416351-57416373 GTTATGAGGTGCTCTCTAAAAGG No data
930972686_930972692 29 Left 930972686 2:57416300-57416322 CCAGTATTTATTTCTCAAATGAT No data
Right 930972692 2:57416352-57416374 TTATGAGGTGCTCTCTAAAAGGG No data
930972686_930972688 6 Left 930972686 2:57416300-57416322 CCAGTATTTATTTCTCAAATGAT No data
Right 930972688 2:57416329-57416351 GAGAAAATCAGTTTCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930972686 Original CRISPR ATCATTTGAGAAATAAATAC TGG (reversed) Intergenic
No off target data available for this crispr