ID: 930972686 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:57416300-57416322 |
| Sequence | ATCATTTGAGAAATAAATAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930972686_930972689 | 14 | Left | 930972686 | 2:57416300-57416322 | CCAGTATTTATTTCTCAAATGAT | No data | ||
| Right | 930972689 | 2:57416337-57416359 | CAGTTTCTCCAGAGGTTATGAGG | No data | ||||
| 930972686_930972691 | 28 | Left | 930972686 | 2:57416300-57416322 | CCAGTATTTATTTCTCAAATGAT | No data | ||
| Right | 930972691 | 2:57416351-57416373 | GTTATGAGGTGCTCTCTAAAAGG | No data | ||||
| 930972686_930972692 | 29 | Left | 930972686 | 2:57416300-57416322 | CCAGTATTTATTTCTCAAATGAT | No data | ||
| Right | 930972692 | 2:57416352-57416374 | TTATGAGGTGCTCTCTAAAAGGG | No data | ||||
| 930972686_930972688 | 6 | Left | 930972686 | 2:57416300-57416322 | CCAGTATTTATTTCTCAAATGAT | No data | ||
| Right | 930972688 | 2:57416329-57416351 | GAGAAAATCAGTTTCTCCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930972686 | Original CRISPR | ATCATTTGAGAAATAAATAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||