ID: 930972689

View in Genome Browser
Species Human (GRCh38)
Location 2:57416337-57416359
Sequence CAGTTTCTCCAGAGGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930972686_930972689 14 Left 930972686 2:57416300-57416322 CCAGTATTTATTTCTCAAATGAT No data
Right 930972689 2:57416337-57416359 CAGTTTCTCCAGAGGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930972689 Original CRISPR CAGTTTCTCCAGAGGTTATG AGG Intergenic
No off target data available for this crispr