ID: 930979318

View in Genome Browser
Species Human (GRCh38)
Location 2:57503477-57503499
Sequence GGATTAAAGGAAATAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930979316_930979318 -3 Left 930979316 2:57503457-57503479 CCAACTAGGAGTTTGTTGTAGGA No data
Right 930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG No data
930979313_930979318 12 Left 930979313 2:57503442-57503464 CCAGATGTGGGAAAACCAACTAG No data
Right 930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930979318 Original CRISPR GGATTAAAGGAAATAGAAAA TGG Intergenic
No off target data available for this crispr