ID: 930981271

View in Genome Browser
Species Human (GRCh38)
Location 2:57528779-57528801
Sequence AGGGAGAGTTAAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930981271_930981275 9 Left 930981271 2:57528779-57528801 CCCACAATCACTTAACTCTCCCT No data
Right 930981275 2:57528811-57528833 ATATAGATTCTCTCTCCACAAGG No data
930981271_930981277 27 Left 930981271 2:57528779-57528801 CCCACAATCACTTAACTCTCCCT No data
Right 930981277 2:57528829-57528851 CAAGGCAAGCTGTGCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930981271 Original CRISPR AGGGAGAGTTAAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr