ID: 930984868

View in Genome Browser
Species Human (GRCh38)
Location 2:57573175-57573197
Sequence AAGCAGCCTGAAGCCCTCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930984865_930984868 1 Left 930984865 2:57573151-57573173 CCCTTCACCTTCTACAATGAGTA No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984867_930984868 -6 Left 930984867 2:57573158-57573180 CCTTCTACAATGAGTAGAAGCAG No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984864_930984868 2 Left 930984864 2:57573150-57573172 CCCCTTCACCTTCTACAATGAGT No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984861_930984868 18 Left 930984861 2:57573134-57573156 CCTGTACTTGCCACCTCCCCTTC No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984862_930984868 8 Left 930984862 2:57573144-57573166 CCACCTCCCCTTCACCTTCTACA No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984863_930984868 5 Left 930984863 2:57573147-57573169 CCTCCCCTTCACCTTCTACAATG No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984860_930984868 19 Left 930984860 2:57573133-57573155 CCCTGTACTTGCCACCTCCCCTT No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data
930984866_930984868 0 Left 930984866 2:57573152-57573174 CCTTCACCTTCTACAATGAGTAG No data
Right 930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930984868 Original CRISPR AAGCAGCCTGAAGCCCTCAT CGG Intergenic
No off target data available for this crispr