ID: 930987286

View in Genome Browser
Species Human (GRCh38)
Location 2:57605786-57605808
Sequence AGCAACTTTGGCAAGGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987286_930987294 14 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987294 2:57605823-57605845 GTTTTTGGGCTGAGACGTTGGGG No data
930987286_930987292 12 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data
930987286_930987291 0 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987291 2:57605809-57605831 TATCAGCTTAAGGAGTTTTTGGG 0: 329
1: 10618
2: 5358
3: 2499
4: 1954
930987286_930987290 -1 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987290 2:57605808-57605830 TTATCAGCTTAAGGAGTTTTTGG 0: 558
1: 10672
2: 5569
3: 2403
4: 1397
930987286_930987293 13 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987293 2:57605822-57605844 AGTTTTTGGGCTGAGACGTTGGG No data
930987286_930987289 -10 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987289 2:57605799-57605821 CAAAGTTGCTTATCAGCTTAAGG 0: 24
1: 296
2: 10488
3: 5081
4: 1986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987286 Original CRISPR AGCAACTTTGGCAAGGTCTT AGG (reversed) Intergenic
No off target data available for this crispr