ID: 930987287

View in Genome Browser
Species Human (GRCh38)
Location 2:57605793-57605815
Sequence GCTGATAAGCAACTTTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987287_930987293 6 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987293 2:57605822-57605844 AGTTTTTGGGCTGAGACGTTGGG No data
930987287_930987292 5 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data
930987287_930987290 -8 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987290 2:57605808-57605830 TTATCAGCTTAAGGAGTTTTTGG 0: 558
1: 10672
2: 5569
3: 2403
4: 1397
930987287_930987294 7 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987294 2:57605823-57605845 GTTTTTGGGCTGAGACGTTGGGG No data
930987287_930987291 -7 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987291 2:57605809-57605831 TATCAGCTTAAGGAGTTTTTGGG 0: 329
1: 10618
2: 5358
3: 2499
4: 1954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987287 Original CRISPR GCTGATAAGCAACTTTGGCA AGG (reversed) Intergenic
No off target data available for this crispr