ID: 930987288

View in Genome Browser
Species Human (GRCh38)
Location 2:57605798-57605820
Sequence CTTAAGCTGATAAGCAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 111, 1: 101, 2: 59, 3: 50, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987288_930987292 0 Left 930987288 2:57605798-57605820 CCAAAGTTGCTTATCAGCTTAAG 0: 111
1: 101
2: 59
3: 50
4: 130
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data
930987288_930987293 1 Left 930987288 2:57605798-57605820 CCAAAGTTGCTTATCAGCTTAAG 0: 111
1: 101
2: 59
3: 50
4: 130
Right 930987293 2:57605822-57605844 AGTTTTTGGGCTGAGACGTTGGG No data
930987288_930987294 2 Left 930987288 2:57605798-57605820 CCAAAGTTGCTTATCAGCTTAAG 0: 111
1: 101
2: 59
3: 50
4: 130
Right 930987294 2:57605823-57605845 GTTTTTGGGCTGAGACGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987288 Original CRISPR CTTAAGCTGATAAGCAACTT TGG (reversed) Intergenic
902660623 1:17899623-17899645 CTAGACCTGATAAACAACTTTGG + Intergenic
904840664 1:33369977-33369999 CTGAAGCTGGAAAGCATCTTTGG + Intronic
905963241 1:42063499-42063521 CTTAAGCTGATAAGCAACGTTGG + Intergenic
906738309 1:48154266-48154288 CTTAAGCTGATAAGCAACTTCGG + Intergenic
907027539 1:51135931-51135953 CTTAAGCTGATAAACAACTTTGG + Intronic
907139447 1:52172868-52172890 CTTAAGCTGATAAGCAACTTCGG - Intronic
908453337 1:64277696-64277718 CTTAAGCTGATAAGCAACTTCGG + Intergenic
908583782 1:65546675-65546697 CTTAAGCTGATAAGCAACTTCGG - Intronic
908665483 1:66485061-66485083 CTTAAGCTGATAAGCAACTTCGG + Intergenic
908902044 1:68966761-68966783 CTTAAGCTGATATGCAATTTTGG + Intergenic
908930151 1:69308289-69308311 CTTAACCTGATAAGTAATTTCGG - Intergenic
909683060 1:78314275-78314297 CTTAAGCTGATAAGCAACTTCGG + Intronic
910531574 1:88242045-88242067 CTTAAGCTGATAAGTAACCTCGG + Intergenic
910912927 1:92257029-92257051 CTTAAGCTGATAAGCAACTTTGG + Intronic
911851886 1:102830769-102830791 CTTAAGCTGATAGGCAACTTCGG + Intergenic
912279698 1:108300126-108300148 CTTGAGCTGATAAACAACTTTGG - Intergenic
912288528 1:108394231-108394253 CTTGAGCTGATAAACAACTTTGG + Intronic
912880995 1:113413745-113413767 CTTAAGCTGATAAGCAACCTCGG - Intronic
915182441 1:154074107-154074129 CTTCAGCAGATAATCAAATTTGG - Intronic
915776299 1:158491447-158491469 AATAAGTTGATAAGCATCTTGGG - Intergenic
915987087 1:160477173-160477195 CTTAAGCTGATAAGCAACTTCGG - Intergenic
916599572 1:166278819-166278841 CTTCAGCTGATAAATAACTTCGG - Intergenic
917011517 1:170479566-170479588 CTATATCTGATAAACAACTTTGG - Intergenic
917270066 1:173262911-173262933 CTTAAGCTGATAAACAACTTCGG + Intergenic
917361223 1:174178335-174178357 CTTAAGCTGATAAGCAACTTCGG - Intronic
918252038 1:182711453-182711475 CTTAAGCTGGGAAGCAAAATAGG + Intergenic
918616199 1:186547169-186547191 TTTAAGCTGATAAGCAACTTCGG - Intergenic
918696947 1:187556603-187556625 CTTAAGCTGATAAGTAACTTCGG - Intergenic
921104665 1:211964114-211964136 CTTAAGCTGATAAACAACTTCGG + Intronic
921331910 1:214047590-214047612 CTTAAGCTGATAAGCAACTTTGG + Intergenic
921343572 1:214158509-214158531 CTTAGGCTGATCAGCTACCTTGG - Intergenic
923943142 1:238852049-238852071 CTTAAGATGATAGGGAACTTCGG - Intergenic
924179578 1:241426842-241426864 CTTAAGCTGGCAAGCAACTTTGG - Intergenic
924251565 1:242138356-242138378 CAGAATCTGATAAGCAGCTTAGG + Intronic
924398504 1:243651260-243651282 CTTAAGCTGATATGCAACTTCGG - Intronic
1064792466 10:18973517-18973539 CTTAAGCTGATAAGCAACTTAGG + Intergenic
1065874779 10:29987789-29987811 ATCAAGCTGAAAAGGAACTTCGG - Intergenic
1066247756 10:33599841-33599863 CTTAAGGTGAGATGCAGCTTTGG - Intergenic
1066514045 10:36135716-36135738 CAAAAGCTGAAAAGCAAGTTTGG - Intergenic
1066575829 10:36823726-36823748 CCTAGGCTGATAAACAGCTTTGG - Intergenic
1067914868 10:50386686-50386708 CTTAACCTGCTAGGCAATTTGGG - Intronic
1068906035 10:62323826-62323848 CTTCAGCTGGTAAACAAGTTTGG + Intergenic
1069233304 10:66039019-66039041 ATTAAGCTGATAAACAACTTTGG + Intronic
1071452484 10:85810448-85810470 CTTGAGCTGCTAAGCAGCTGTGG + Intronic
1072053630 10:91731309-91731331 CTTAAGCTGAAATGTATCTTTGG - Intergenic
1072493297 10:95930262-95930284 CTTAAGCTGATAAGCAACTTCGG - Intronic
1073927084 10:108529597-108529619 CATAAGCTGACAAAAAACTTCGG + Intergenic
1076938658 10:133584821-133584843 CTCAAGCTGATAAGCAACTTCGG + Intergenic
1078694400 11:13616179-13616201 CTAGAACTGATAAACAACTTCGG - Intergenic
1079426459 11:20346919-20346941 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1080118324 11:28645543-28645565 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1081363673 11:42209642-42209664 CTTAAGCTAATAAGCAACTTCGG + Intergenic
1085364054 11:75921348-75921370 CTTAAGCTTATTAGCTATTTAGG + Intronic
1086294633 11:85351277-85351299 CTTAAGCTGATAAGCAGCTTTGG - Intronic
1086574503 11:88323544-88323566 CTTAAGCTGATAAGCAACTTCGG + Intronic
1086599106 11:88610585-88610607 CTAGAACTGATAAACAACTTCGG - Intronic
1086985583 11:93245426-93245448 TTTAACCTGATAAGCAATTTCGG + Intergenic
1087337196 11:96859556-96859578 CTTAAGCTGATAAACAACTTTGG - Intergenic
1087753744 11:102033288-102033310 CTTAAGTTGATAAGCAAATTCGG - Intergenic
1088425811 11:109700723-109700745 CTGGAACTGATAAACAACTTCGG + Intergenic
1092661652 12:10745131-10745153 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1093199884 12:16173740-16173762 CTTAAAAGGATAAGCAACTCTGG - Intergenic
1093968083 12:25347929-25347951 CTCAAGCTGATCATCAACTATGG - Intergenic
1094732614 12:33195749-33195771 CTCAAGCTGATAAGCAACTTTGG - Intergenic
1095509949 12:42940359-42940381 CTTAAGCTGATAAGCAACTTTGG - Intergenic
1095836257 12:46642292-46642314 CTTCAGCTGATAAATAACTTTGG + Intergenic
1096953969 12:55506562-55506584 CTTAAGCTGATAGGCAACTTCGG - Intergenic
1097634217 12:62102724-62102746 TTTAAGCTGATGAGGAAATTGGG - Intronic
1097917069 12:65032315-65032337 CTTAGGCTGATGGGCAACTTTGG - Intergenic
1098821472 12:75236117-75236139 GTTAAGTTGAATAGCAACTTTGG + Intergenic
1098830394 12:75354277-75354299 TTTAAGCTTATAAGCAACTTTGG + Intronic
1099500089 12:83403391-83403413 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1100941490 12:99727263-99727285 CTTAAACTGATAAGCAACTTTGG + Intronic
1102594615 12:113982885-113982907 CTTAAATAAATAAGCAACTTTGG + Intergenic
1104396206 12:128435424-128435446 CTTAAGCTGATAAGCAACTTTGG + Intronic
1104499088 12:129267308-129267330 CTTAAGCTGATAGGCAACTTCGG + Intronic
1104507544 12:129346831-129346853 CTTAAGCTGATAGGCAACTTCGG + Intronic
1105643405 13:22289745-22289767 CTGAAGCTAATAAACAATTTAGG - Intergenic
1105668088 13:22582748-22582770 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1106817249 13:33422220-33422242 CTTAAGCTGATACGCAACTTCGG + Intergenic
1108449390 13:50545854-50545876 CGTAAGCTGATAAGCGACTTCGG + Intronic
1108908303 13:55507733-55507755 TTTAATCTGATCACCAACTTTGG + Intergenic
1109020264 13:57082204-57082226 CTTAACCTGATAAGCAACTTTGG - Intergenic
1110381633 13:74858273-74858295 CTTAGGCTGATAAGCTGCTTTGG - Intergenic
1110387817 13:74935119-74935141 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1112720514 13:102238958-102238980 ATTAAGCAGATAGGCAACATAGG - Intronic
1112736154 13:102421364-102421386 CTTCAGCTGATAAACAACTTTGG + Intergenic
1112899577 13:104342219-104342241 CTTAAGCTGATAAGCGACTTTGG - Intergenic
1113202276 13:107879501-107879523 CTAGAACTGATAATCAACTTCGG + Intergenic
1114845276 14:26313171-26313193 CTTAGGCTGATAAGCAACTTCGG + Intergenic
1115668855 14:35586316-35586338 CTTAAGCTGACAAGCAACTTCGG - Intronic
1115671736 14:35620636-35620658 CTTAAGCTGACAAGCAACTTCGG + Intronic
1115832665 14:37359694-37359716 CTTAAGTTGATAAGCAAATTAGG - Intronic
1116145779 14:41066656-41066678 ATGAAGCTTATTAGCAACTTAGG + Intergenic
1116147261 14:41090101-41090123 CTTAAACTGATAGGCTGCTTCGG + Intergenic
1116438761 14:44925861-44925883 CTTAATCTGTTAGGCACCTTTGG - Exonic
1116494744 14:45547595-45547617 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1120396750 14:83976539-83976561 ATTAAGGTGATAAACACCTTTGG - Intergenic
1120717738 14:87858288-87858310 CTTAAGCTGATAAGCAACTTCGG + Intronic
1124084594 15:26535668-26535690 CTTAAGTTGATAAGCAACTTTGG + Intergenic
1125009354 15:34853866-34853888 CAAATGCTGATAAGCAAATTAGG + Exonic
1125220226 15:37324212-37324234 TTTAAGCTGATAAGTGACTTCGG + Intergenic
1126046376 15:44644698-44644720 CTGGATCTGATAAACAACTTTGG + Intronic
1127022002 15:54758624-54758646 CTTGATCTGATAAACAACTTTGG + Intergenic
1127580421 15:60333979-60334001 CTGAAGCTGATAAGCAACTTCGG + Intergenic
1136643132 16:31584907-31584929 CTTGAGCTGATAAGCAACTTCGG - Intergenic
1137064854 16:35829602-35829624 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1138783205 16:59813567-59813589 CTTAAGCTGATAAGCAATCTCGG + Intergenic
1139040512 16:62994234-62994256 CTTAAGCTGATAAGCAACTTTGG - Intergenic
1140301410 16:73761108-73761130 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1140669002 16:77256186-77256208 CTTAAGGTGATAAGCAACTTCGG - Intronic
1142346460 16:89557152-89557174 CCTCAGCTGAAAAGCAACTCAGG - Exonic
1143934015 17:10463151-10463173 CTTTAGCTGAAAAGTAACTCGGG + Exonic
1144294414 17:13859714-13859736 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1144899838 17:18574834-18574856 CTAAAAGTGATAAGCAGCTTTGG + Intergenic
1145132606 17:20370835-20370857 CTAAAAGTGATAAGCAGCTTTGG - Intergenic
1146740586 17:35279766-35279788 CTTAAGCTGATAGGCAACTTCGG + Intergenic
1148981427 17:51578947-51578969 TTTAAGCTGATAAGCAACTTCGG + Intergenic
1149395413 17:56236557-56236579 CTTCAGCTAATAAACAACTTCGG - Intronic
1151253729 17:72858862-72858884 CTTTAGCTGATAAACAACTTAGG - Intronic
1155644874 18:28065002-28065024 CTTATGATGGTAAGCAGCTTTGG - Intronic
1155856932 18:30846131-30846153 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1157464618 18:47932085-47932107 CTAAAGTTGAAAAGAAACTTAGG + Intergenic
1158036810 18:53041875-53041897 CTAAAGCTGATAAGCAACTTCGG - Intronic
1158581357 18:58686523-58686545 CTGGAGCTGAAAAGCAACTTGGG - Intronic
1159831357 18:73281749-73281771 CTTAAGCTGATAATACAGTTGGG + Intergenic
1159978994 18:74753250-74753272 CTTAAGCTGATAAGCAACTTCGG - Intronic
1160601600 18:80017229-80017251 CTTAAGCTGATAAGCAACTTTGG - Intronic
1164039200 19:21479988-21480010 CTTAAGCTGATAAACAACTTTGG - Intronic
1164209597 19:23087475-23087497 CTTAAGCTGATAAACAACTTTGG - Intronic
925441360 2:3889172-3889194 CTTAAGCTGATAAGCAACTTTGG - Intergenic
925728715 2:6900685-6900707 TTTAAGCTGATAAGCAACTTTGG - Intergenic
926520735 2:13910129-13910151 CTTAAGCTGATAAGCAACTTCGG + Intergenic
928154588 2:28865509-28865531 CTCAGCCTGATAAGCAACTAGGG + Intronic
928461782 2:31481184-31481206 CTTCAGCTGATAAACAACTTCGG - Intergenic
930987288 2:57605798-57605820 CTTAAGCTGATAAGCAACTTTGG - Intergenic
931557755 2:63523578-63523600 CTTGATCTGATAAACAACTTGGG + Intronic
932962611 2:76431929-76431951 AATAAGTTGATCAGCAACTTTGG + Intergenic
933023470 2:77223483-77223505 CTTAAGCTGATAAGCAACTTCGG + Intronic
933050607 2:77596956-77596978 CTTAAGCTGATAAGCAACTTCGG + Intergenic
933605652 2:84379854-84379876 CTGGAACTGATAAACAACTTTGG + Intergenic
933932208 2:87164379-87164401 CTTAAGCTGAAAATACACTTAGG - Intergenic
936360906 2:111801054-111801076 CTTAAGCTGAAAATACACTTAGG + Intronic
936825168 2:116573253-116573275 CTTAAGTTGATAAGCAACTTTGG + Intergenic
937467070 2:122142803-122142825 CTTAAGCTGATAAGCAACTTCGG - Intergenic
939133248 2:138262956-138262978 CTTAAGCTGATAAATAACTTCGG - Intergenic
940361164 2:152797643-152797665 TCTAAGCTGATAAGCAAGTGTGG - Intergenic
943087167 2:183326219-183326241 ATTAAGCTGATAAGCAACTTTGG + Intergenic
943281393 2:185938436-185938458 TTAGAGCTGATAAGCAAATTTGG - Intergenic
943500961 2:188689272-188689294 CTTAAGTTTATAAACAACTTCGG - Intergenic
944009447 2:194955901-194955923 CTTAAGCTGATAAGCAACTTCGG - Intergenic
944922531 2:204430460-204430482 CTTAAGTTGGTAAGCAAAATAGG - Intergenic
945475395 2:210276072-210276094 CTTAGGCTGATAAGCAACTTCGG - Intergenic
945524395 2:210870195-210870217 CTTAAGGCGATAAGCAACTTTGG + Intergenic
947301531 2:228693141-228693163 CTTAAGCTGATAAGCAACTTTGG - Intergenic
947811805 2:233009495-233009517 TTTAAACTCATCAGCAACTTGGG + Intronic
1169959945 20:11148569-11148591 CTTAAGCTGATAAGCAAATTTGG - Intergenic
1170484107 20:16798128-16798150 CTTAAGCTGATAAGCAACTCCGG + Intergenic
1173477316 20:43369850-43369872 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1175627093 20:60498380-60498402 CTTTAGCTGCTAAGTCACTTAGG + Intergenic
1176704620 21:10103900-10103922 CTTAAGATGAAAAACACCTTTGG - Intergenic
1178160098 21:29902421-29902443 CTTAAGCTGATGAGCAACTTTGG + Intronic
1178216770 21:30607214-30607236 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1179031316 21:37722071-37722093 CTGGAACTGATAAACAACTTCGG + Intronic
1179055035 21:37923493-37923515 TTTAGGCTCATAAGAAACTTTGG + Intergenic
1179196406 21:39167444-39167466 TTAAAGCTGATAAGCAAATTTGG - Intergenic
1179372214 21:40816945-40816967 CTAAAGCTGATGATGAACTTTGG + Intronic
1180249470 21:46571766-46571788 CTTACTCTGATAAGCAACTTCGG - Intergenic
950599723 3:14022529-14022551 CTTCAGCTGATAAACAACTTTGG - Intronic
951181297 3:19662304-19662326 ACTAATCTGATAATCAACTTGGG - Intergenic
951364898 3:21769359-21769381 CTTAAGCCGATAAGCAACTTCGG + Intronic
951789845 3:26468292-26468314 CTTAAGCTGATAAGCAACTTCGG + Intergenic
952187431 3:30985115-30985137 CTAAAGCTGATAAGGAAGTTGGG + Intergenic
952721252 3:36535339-36535361 CTTAAGCTGATTCACAGCTTTGG - Intronic
953491591 3:43356969-43356991 CTTCAGCTGATAAACAACTTTGG + Intronic
954490819 3:50903038-50903060 CTTAAGCTGATAGGCCACATCGG - Intronic
954500408 3:51008495-51008517 CTTAAGCTGATAAGCAACTTTGG - Intronic
955650502 3:61189207-61189229 CTTAAGCTGATAGGTAACTTCGG + Intronic
957010855 3:75004733-75004755 CTTAAGCTGATAAGCAACTTCGG - Intergenic
957108213 3:75918904-75918926 CTTAACCTGATAAACAACTTTGG - Intronic
957470425 3:80652254-80652276 CTGGAGCTGATAGGCCACTTAGG + Intergenic
957492457 3:80946360-80946382 TTAAATCTGATAAGCAAGTTCGG - Intergenic
957580202 3:82062338-82062360 CTGGAGCTGATAAACAAATTCGG - Intergenic
957639296 3:82830595-82830617 CTTAAGCTAATAAGCAACTTTGG + Intergenic
958649793 3:96924511-96924533 CTTAAGCTGATAAGCAACTTCGG - Intronic
959092686 3:101920921-101920943 CTTAAGCTGATAAGCAACTTCGG - Intergenic
959876062 3:111383488-111383510 CTTTTGCTGATAAGCAACTTCGG + Intronic
959997116 3:112692557-112692579 TTTAAGCAGATAAACAACTTTGG - Intergenic
960065765 3:113370854-113370876 CTTAAGCTGATAAACAACTTCGG + Intronic
960309324 3:116100966-116100988 CATAAGCTGAGAATCAACTAGGG - Intronic
960754668 3:120998356-120998378 CTTGATCTGATAAACATCTTTGG + Intronic
960786390 3:121377095-121377117 CTTCAGCTGATAAGCAACTTCGG - Intronic
962639762 3:137373172-137373194 CTTCAGCTGATAAGCAACTTTGG - Intergenic
962690089 3:137887062-137887084 CTTAAGCTGATAATCAACTTCGG + Intergenic
962725598 3:138223786-138223808 CTGAAGATGCTAAGCAAATTAGG - Intronic
962993228 3:140598928-140598950 CTTTAGCTGATAAGTCAATTTGG + Intergenic
963057505 3:141198721-141198743 TATAAGCTGATAAACAACTTCGG + Intergenic
963364500 3:144317816-144317838 CTTAAGCTGTAAAGCAACAGTGG + Intergenic
963400073 3:144787139-144787161 CTTAAGCTAATAAGCAACTTGGG - Intergenic
963831024 3:150009439-150009461 CTTCAGCTGATAAACAACTTCGG + Intronic
963927181 3:150963188-150963210 CTTAAGCTGATAAGCAACTTCGG + Intronic
964007384 3:151848137-151848159 CTTAAGCTGATGAGCAGTTTAGG - Intergenic
964460215 3:156916622-156916644 CTTCAGCTGATAAACAGCTTTGG - Intronic
965159911 3:165119672-165119694 CTTAAGCTGGTAAACAACTTCGG - Intergenic
966251448 3:177869895-177869917 CTTAAGCTGATAAACAACTTTGG + Intergenic
966582780 3:181587269-181587291 CTTAAGCTGATAAGCAAATTCGG - Intergenic
969132100 4:4998248-4998270 CTTAAGCTGATAAGCAACTTCGG - Intergenic
969906217 4:10398527-10398549 CCCAAACTGATAAGCAACGTAGG - Intergenic
969952259 4:10850001-10850023 CTTAAGCTGATAAGCAAATTTGG - Intergenic
970170668 4:13286659-13286681 CTAGATCTGATAAGCAACTTTGG - Intergenic
972214994 4:36887468-36887490 CTATATCTGATAAACAACTTTGG - Intergenic
973203257 4:47530011-47530033 CTATACTTGATAAGCAACTTTGG - Intronic
973295569 4:48516512-48516534 CTACAGCTGAGAAGTAACTTAGG - Intronic
974177024 4:58337585-58337607 CTTAAGCTGATAAGCAACTTGGG + Intergenic
974536367 4:63180699-63180721 CTTAAGCTGATAAGCAACTTTGG - Intergenic
974581600 4:63810731-63810753 TTTTAGCTGATAAACAACTTCGG - Intergenic
974899324 4:67977996-67978018 CTTCTGCTGATAAGCAACTTCGG - Intergenic
975073203 4:70169899-70169921 CTTACTCTGATATGGAACTTTGG - Intronic
975166460 4:71183303-71183325 CTAAAGCTGTGAAGCAACTTGGG + Intergenic
976769813 4:88638865-88638887 CTTGAGCCGATAAGCAACTTAGG + Intronic
977186750 4:93948256-93948278 CTGGAACTGATAAACAACTTCGG + Intergenic
977455640 4:97256464-97256486 CTTAAGCTGATAAGCAACTTCGG - Intronic
977743511 4:100516502-100516524 CATTAGCTTATAAGTAACTTCGG - Intronic
979035171 4:115706928-115706950 CTTAAGCTGATAAGCACCTTCGG - Intergenic
979190873 4:117856993-117857015 CTCGAGCTGATAAACAACTTCGG - Intergenic
979976192 4:127198817-127198839 CTAGACCTGATAAACAACTTCGG + Intergenic
980376836 4:131960349-131960371 CTTAAGATGAAAAACACCTTTGG - Intergenic
980450383 4:132961326-132961348 CTCATGCTGAAAAGCAACTTTGG - Intergenic
980516972 4:133876860-133876882 CTTGATCTGATAAACAACTTTGG - Intergenic
980674988 4:136066850-136066872 CTGGAGTTGATAAGCAACCTCGG - Intergenic
980865221 4:138546462-138546484 CTTAAGCTGATAAGCAACTTCGG + Intergenic
981479641 4:145224947-145224969 CTTAAGCTGATAAGCAACTTCGG - Intergenic
982732953 4:158976154-158976176 CTTAAGCTGATAAGCAACTTTGG - Intronic
982734272 4:158989008-158989030 CTTAAGCTGATAAGCAACTTTGG + Intronic
984244202 4:177255104-177255126 CTTAAGCTGATAAGCAACTTCGG + Intergenic
984244586 4:177259768-177259790 CTTATGCTGATAAGCAACTTCGG - Intergenic
987260800 5:16200693-16200715 CTTAAGCTGATAAGCGACTTTGG + Intergenic
987553178 5:19410275-19410297 CTGAAGCTAATGAACAACTTTGG - Intergenic
987596759 5:20011321-20011343 CTTAAGCTGATAAGAAACTTTGG - Intronic
988012827 5:25512501-25512523 CTTAAGCTGATAAGCAACTTTGG - Intergenic
989517249 5:42357773-42357795 CTTAAGCTGATAAGCAAATTAGG + Intergenic
989739959 5:44759177-44759199 CTCAAGCTGATAAGCAACTTCGG + Intergenic
989825720 5:45852135-45852157 CTTAAGCTGATAAGCAACTTCGG + Intergenic
989955430 5:50353769-50353791 TTTAAGTTCATAAGCCACTTAGG + Intergenic
990408869 5:55520423-55520445 ATTAAGCTAATAAGCCAATTTGG - Intronic
990993653 5:61709624-61709646 CTTAAGCTGATAAGCAACTCCGG + Intronic
991025320 5:62023124-62023146 CTTAAGCTGATAAGCAACTTCGG - Intergenic
991534394 5:67650718-67650740 CTTAGGCTGATGAGCAATGTTGG + Intergenic
992038445 5:72805049-72805071 CTTAGGCTGGTGAGCAATTTCGG - Intergenic
992369827 5:76131467-76131489 CTTAAGCAGAGAAGCAGCCTAGG + Intronic
992875881 5:81054993-81055015 CTTAAGCTGATAAGCAACTTCGG - Intronic
993144200 5:84073471-84073493 CTTAAGCTGATAAGCAACTTCGG + Intronic
993609406 5:90035775-90035797 CTTAAGCTGTTAAGCAACTTAGG + Intergenic
993837312 5:92831346-92831368 ATAAAGCTGATAAGCAACTTCGG - Intergenic
993842232 5:92893786-92893808 CTTAAGCTGCTAAGCAACTTCGG + Intergenic
994277754 5:97859297-97859319 CTTAAGTTGATAAACAACTTCGG + Intergenic
994586880 5:101720106-101720128 CATAAGCTGATGGGCAACCTGGG + Intergenic
994642337 5:102425394-102425416 CTTAAGAGGATAAGAAACTTTGG + Intronic
995386202 5:111592331-111592353 CTTAAGCTGATAAGCAACTTTGG + Intergenic
995416392 5:111917982-111918004 CCTTAGCTCATAAACAACTTAGG + Intronic
995689996 5:114815034-114815056 CTTAAGCTGATAAGCAACTTTGG - Intergenic
995703863 5:114964884-114964906 CTTGATCTGATAAACAATTTAGG - Intergenic
996481846 5:123984586-123984608 CTTAAGCTGATAAGGAACTTTGG - Intergenic
996838095 5:127816339-127816361 CTAAAGCTAATAAGCAAATTTGG + Intergenic
997075144 5:130665706-130665728 CTTAAGCTGATAAGCAACTTTGG - Intergenic
997219896 5:132152957-132152979 CTTAAGCTGACAAGCAACTTCGG - Intergenic
998574887 5:143304187-143304209 CTGGAGCTGATAAACAACTTTGG + Intronic
998724726 5:144997280-144997302 CTTAAGCTGATAAGCAACTTCGG + Intergenic
998774477 5:145583565-145583587 CTTAAGCAGATAAGCAGCTTAGG + Intronic
999899387 5:156069997-156070019 CTTAAGCTGATAAGCAACTTTGG - Intronic
1000534983 5:162468869-162468891 CATAAGCACATAAGCAACATGGG - Intergenic
1001851082 5:174966306-174966328 CTTGACCTGATAACCAACTTTGG - Intergenic
1002967625 6:1982507-1982529 CTGAAGTTGATAAGCAACTTTGG + Intronic
1004352195 6:14899744-14899766 CTTAAGCTAATAAGCAACTTTGG + Intergenic
1005904677 6:30251498-30251520 CTTAAGCTGCTAAGCAACTTCGG + Intergenic
1006962845 6:37951241-37951263 CTAGATCTGATAAACAACTTCGG - Intronic
1007101734 6:39252871-39252893 CTTGAACTGATAAGCAACTTCGG - Intergenic
1008529381 6:52441967-52441989 CTTAAGTTAATAAACAACTTCGG - Intronic
1008920573 6:56840447-56840469 CTTCAGCTGATACCAAACTTCGG - Intronic
1008962991 6:57285881-57285903 CTTAAGCTGATAAAGAGCTTTGG + Intergenic
1008978219 6:57453653-57453675 CTTAAGCTGATAGGCAACTTCGG - Intronic
1009453993 6:63833341-63833363 CTTAAGCTGATAAGCAACTTCGG + Intronic
1009512694 6:64572549-64572571 CTTAAGCTGATTAGCAAATTTGG + Intronic
1010019938 6:71147560-71147582 CTTCAGTTGATAAACAACTTCGG + Intergenic
1010297663 6:74219172-74219194 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1010476546 6:76295407-76295429 CTTAAACTGATAGGCAAATTTGG - Intergenic
1010629272 6:78177707-78177729 CTGGAACTGATAAACAACTTTGG + Intergenic
1010677608 6:78762387-78762409 TTTAAGCTGATAAGCAACTTTGG + Intergenic
1010836691 6:80597183-80597205 CTTAAGCTGATAAGTAACTTAGG - Intergenic
1010883396 6:81208081-81208103 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1011136839 6:84109528-84109550 CTTAAACTAATAAGCAACTTCGG - Intergenic
1011924795 6:92628611-92628633 CTTAAGCTAATAAGCGACTTTGG + Intergenic
1011950243 6:92956126-92956148 CTTAAGCTAATAAGCAACTTTGG + Intergenic
1012297837 6:97546855-97546877 CTTAAGCTCATATGCCAGTTGGG - Intergenic
1012573389 6:100760020-100760042 CTTAAACTAATAAGCAACTTGGG - Intronic
1012598508 6:101067399-101067421 CTTAAACTGATAAGCAACTTCGG + Intergenic
1012904431 6:105047885-105047907 CTTAAGCCGATAAGCAAATTTGG - Intronic
1013010654 6:106116980-106117002 CTTAAGCTCAGAAGCAACACAGG - Intergenic
1013849657 6:114498425-114498447 CTTCAGCTGATAATCAGCTGGGG + Intergenic
1014567092 6:122962621-122962643 CTAGATCTGATAAGCAACTTTGG + Intergenic
1014613536 6:123574151-123574173 CAAAAGCTGATAAGGAACATCGG + Intronic
1014790834 6:125670092-125670114 CATAAACTGATATGTAACTTAGG - Intergenic
1014868614 6:126562714-126562736 TTTAAGCTGATAAGCAGCTTCGG + Intergenic
1015587756 6:134793469-134793491 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1016394817 6:143612364-143612386 CTTTAGCTGTTCAGGAACTTTGG - Intronic
1016847580 6:148583775-148583797 CTTAAGCCGATAAGCAACTTTGG - Intergenic
1017525880 6:155241034-155241056 CTTTAGGTGATGAGGAACTTGGG + Intronic
1017818946 6:158035519-158035541 CTTAACCTGATAAACAGCTTCGG - Intronic
1018015438 6:159708393-159708415 CTTAAGCTGATAAGCAACTTCGG + Intronic
1018513294 6:164550213-164550235 CTTGAATTGATAAGCAACTTCGG + Intergenic
1020860563 7:13487707-13487729 CTTCAGCTGATAAACAACTTTGG + Intergenic
1021757702 7:23870151-23870173 CTTAAGCTGATAAACAGGTTCGG + Intergenic
1023894738 7:44423416-44423438 CTTAAGCTGATAAGCAACTTCGG + Intronic
1025706430 7:63869230-63869252 CTTATGCCTATAAGCTACTTGGG + Intergenic
1028012899 7:85671751-85671773 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1028099248 7:86799220-86799242 CTTAAGCTGATAAGCAACTTTGG - Intronic
1028346921 7:89794483-89794505 ATTTATCTGATAATCAACTTTGG - Intergenic
1028518603 7:91704544-91704566 CTTAAGCTGATAAGCAGCATCGG + Intronic
1029780016 7:102722489-102722511 CTTAAGCTGATGAGCAACTTCGG - Intergenic
1030413420 7:109211312-109211334 CTTAAGCTGATAAGCAACTTTGG - Intergenic
1030500407 7:110352646-110352668 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1031032470 7:116749733-116749755 CTTAAGCTGATAAGCAACTTCGG + Intronic
1031410876 7:121438924-121438946 CTTAAGCTGATAAGCAACTTAGG + Intergenic
1032647670 7:133843534-133843556 CTTGATCTGATAAGCAACTTTGG - Intronic
1033028933 7:137806324-137806346 CTTAAGCTGTTGTGTAACTTTGG - Intronic
1033776102 7:144613947-144613969 CTTAAGCTGATAAGCAGCTTCGG - Intronic
1033964135 7:146952552-146952574 CTGAAGCTGATAAGCAACTTCGG + Intronic
1034147705 7:148886750-148886772 AGTAATTTGATAAGCAACTTAGG - Intergenic
1034690220 7:153007968-153007990 CTTAACCTGGCCAGCAACTTTGG + Intergenic
1036022237 8:4858539-4858561 CTTAAGCTGATAAACAACTTCGG + Intronic
1036331521 8:7832990-7833012 CTGAAGATGAGAAGCAAGTTAGG + Intergenic
1037429109 8:18790850-18790872 CTCAAGGTGATAAGCAACCTTGG + Intronic
1040038411 8:42893871-42893893 TTTAATCTGATAAGCAGCTGTGG + Intronic
1040736939 8:50519578-50519600 TTTAAGCTGATAAGCTACTTCGG + Intronic
1040756237 8:50779570-50779592 CTTAAGCTGATAAGCAACTTCGG - Intronic
1040763313 8:50876149-50876171 CTTAAGCTGATAAGCAACTTAGG + Intergenic
1040842307 8:51797448-51797470 ATTAAGCTGATAAGCCCCTTTGG + Intronic
1041743471 8:61181108-61181130 CTTAAGTTGATAAGCAACTTCGG + Intronic
1041744406 8:61191649-61191671 CTTAAGCTGATAGGCAACTTTGG + Intronic
1042326727 8:67536563-67536585 CTTAAGCTGATAAGCAACTTCGG - Intronic
1042362504 8:67898526-67898548 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1042473495 8:69218282-69218304 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1042620322 8:70697050-70697072 CTTAAGCTGATAAGCAACTTCGG - Intronic
1042624017 8:70737335-70737357 CTTAAGCTGATAAGCAACTTCGG - Intronic
1042625690 8:70754039-70754061 CTTAAGCTGATAAGCAACTTCGG + Intronic
1042630698 8:70812566-70812588 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1042636389 8:70880397-70880419 CTTAACCTGATAAGCAACTTAGG + Intergenic
1042681900 8:71395158-71395180 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1042713284 8:71743377-71743399 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1042981755 8:74537485-74537507 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1043171687 8:76973631-76973653 CTTAAGCTGATAAGCAACTCAGG + Intergenic
1043381975 8:79712320-79712342 GTTAAGCTGATAAGCAACTTAGG + Intergenic
1043806784 8:84681706-84681728 CTTAAGCTGATAAGCAACTGCGG - Intronic
1043828076 8:84953289-84953311 CTTAAGCTGATAAGCAACCTCGG - Intergenic
1044447170 8:92292682-92292704 CCTAAGCTGATAAGCAACTTCGG - Intergenic
1045157168 8:99489770-99489792 CTTAAGCTGATAAGCAACTTTGG - Intronic
1045184772 8:99826437-99826459 CTTAAGTTGATAAGCAACTTTGG - Intronic
1045732604 8:105259686-105259708 CTTAGACTGATAAGCAACCTCGG - Intronic
1046114868 8:109772797-109772819 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1046192864 8:110821665-110821687 CTTACAGTGATAAGCAACTTCGG + Intergenic
1046292932 8:112186150-112186172 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1046296069 8:112220022-112220044 CTTAAGCTGATAGGCAACTTCGG + Intergenic
1046318225 8:112535295-112535317 CTTAAGCTGATAAGCAACTTCGG + Intronic
1046977899 8:120303105-120303127 CTTCAGCTAATAAACAACTTTGG - Intronic
1047473053 8:125198054-125198076 CTTAAGCTGATAAGCAACTTCGG - Intronic
1047579149 8:126193521-126193543 CTTAAGCTGATAAGCAACTTTGG + Intergenic
1050015417 9:1228011-1228033 CTTAAGCTGATAAGCCACTTCGG + Intergenic
1050129764 9:2399576-2399598 CTTAAGCTGAGAAGCAACTTCGG - Intergenic
1051456506 9:17264907-17264929 CTTAAGCTGATGAGCAACTTCGG - Intronic
1051782201 9:20701857-20701879 CATATGCTGATAAGCTGCTTTGG + Intronic
1051921043 9:22265354-22265376 TTTAGGCTGATAATAAACTTTGG + Intergenic
1051970771 9:22884941-22884963 CTTAAGCTGATAAGCAACTTGGG - Intergenic
1052587055 9:30442347-30442369 CTTAAGTTGATAGGCAACTTCGG - Intergenic
1052627870 9:31000804-31000826 TTTAAGCTGATAGGCAAATTCGG - Intergenic
1053641885 9:40091029-40091051 CTTAAGATGAAAAACACCTTTGG - Intergenic
1053718382 9:40920050-40920072 CTTAAGCTGATAAACAAATTTGG + Intergenic
1053764250 9:41374430-41374452 CTTAAGATGAAAAACACCTTTGG + Intergenic
1054322779 9:63688423-63688445 CTTAAGATGAAAAACACCTTTGG - Intergenic
1054542864 9:66285613-66285635 CTTAAGATGAAAAACACCTTTGG + Intergenic
1054931999 9:70644832-70644854 CTTTAGCTGATAAGAAACTTTGG + Intronic
1055201799 9:73672546-73672568 CTGGAGCTGATAAACAACTTTGG + Intergenic
1055201806 9:73672686-73672708 CTGGAGCTGATAAACAACTTCGG + Intergenic
1055237422 9:74140993-74141015 CTTAAGCTGATAAGCAATTTCGG + Intergenic
1055699762 9:78930611-78930633 CTAAAGATGATAAGCCACTAAGG + Intergenic
1056176166 9:84038309-84038331 CATAAGCTGATAAGCAACTTCGG - Intergenic
1057295976 9:93841217-93841239 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1058361781 9:104155828-104155850 CTTAATCTGAGAAGAAAATTTGG + Intergenic
1058578537 9:106429898-106429920 CTTCAGGTCATAAGCAGCTTTGG + Intergenic
1060336926 9:122733400-122733422 CTTAAGCTGATAAACAACTTTGG + Intergenic
1061833677 9:133314152-133314174 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1202789654 9_KI270719v1_random:73992-74014 CTTAAGATGAAAAACACCTTTGG - Intergenic
1186107362 X:6222085-6222107 TATAAGCTGAAAAGGAACTTGGG - Intronic
1186228690 X:7429199-7429221 ATTAAGGTGATAAGCAGCCTGGG - Intergenic
1186393029 X:9180355-9180377 CTTGGGCTGGTAAGCCACTTAGG - Intergenic
1186679527 X:11856831-11856853 CTTAAGCTGATAAACCACTTCGG + Intergenic
1186812117 X:13200575-13200597 CATAATCTGATAAACTACTTTGG - Intergenic
1187728652 X:22230644-22230666 CTTAAGCTGATAAGCAGCTTCGG - Intronic
1187945462 X:24422423-24422445 CTTGATCTGATAAACAACTTCGG - Intergenic
1189157740 X:38776077-38776099 CATAAGCTGATATACCACTTTGG + Intergenic
1189514189 X:41694810-41694832 CTTAGGCTGAAAAGAAATTTAGG + Intronic
1189581288 X:42409566-42409588 CTTAAGCTAATAAGCAACTTCGG - Intergenic
1189595286 X:42558344-42558366 CTTAAGCTGATCAGCAACTTCGG + Intergenic
1189678708 X:43491290-43491312 CTTAAGCTGATAAACAACTCTGG + Intergenic
1189891475 X:45607371-45607393 CTGTATCTGATAAACAACTTTGG - Intergenic
1189902605 X:45722446-45722468 CTTAATATGATATACAACTTTGG + Intergenic
1189933247 X:46037307-46037329 CTTAACCTTATAACCACCTTGGG - Intergenic
1190803215 X:53812292-53812314 CTTAAGTTGATAAGCAACTTTGG - Intergenic
1190960554 X:55242393-55242415 CTTAAGCTGATAAGCAACTTCGG + Intronic
1191061715 X:56305037-56305059 CTTGATCTGATAAACAATTTCGG - Intergenic
1191122132 X:56917129-56917151 CTTAAGCTGATGAACAACTTCGG - Intergenic
1191181915 X:57573422-57573444 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1191683166 X:63862243-63862265 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1192296769 X:69858097-69858119 CTTAAGCTGATACACAACTTAGG - Intronic
1192300347 X:69894773-69894795 CTTAAGCTGATAAACAACTTTGG - Intronic
1192971673 X:76237939-76237961 CTTTAGCTGATAAACAACTTTGG + Intergenic
1193060442 X:77200428-77200450 CTTCAGCTGACGAACAACTTCGG - Intergenic
1193171754 X:78345406-78345428 GTTAAGCTGATAAGCAACTTTGG + Intergenic
1193267248 X:79486377-79486399 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1193524911 X:82577182-82577204 CCTTTGCTGATAAGCAACTTTGG - Intergenic
1193572010 X:83155440-83155462 CTTCAGCTGATAAGCAACTTTGG + Intergenic
1193623561 X:83788341-83788363 CTTAAACTGATAAGCAACTTTGG + Intergenic
1193688495 X:84609167-84609189 CTTAATGTTATAAACAACTTAGG + Intergenic
1193751755 X:85354581-85354603 CTTAAGCTGATAAGCAACTTCGG + Intronic
1193920542 X:87420015-87420037 CTTGAACTGATAAACTACTTTGG + Intergenic
1194027911 X:88777044-88777066 CTTAAGCTGATAAGGAACTTTGG - Intergenic
1194039907 X:88927950-88927972 CTTAAGTTGATAAGCAACTTCGG + Intergenic
1194118548 X:89933360-89933382 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1194231775 X:91333418-91333440 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1194547927 X:95261187-95261209 CTTAAGCTAATAAGCAATTTCGG + Intergenic
1195143163 X:101984764-101984786 CTGAAGCTAATAAACAAATTAGG + Intergenic
1195288999 X:103413731-103413753 CTTAAGCTGATAAACAATGTCGG - Intergenic
1195624291 X:106991600-106991622 ATTAAGAAGATAAGCAATTTTGG + Intronic
1195784877 X:108508162-108508184 CTTCAGCTGATAAACAACTTTGG + Intronic
1196280731 X:113821060-113821082 CTTAAGCTGATAAGCAACTTTGG - Intergenic
1197313607 X:124936499-124936521 ATTGAGCTGATAAACTACTTAGG - Intronic
1197418455 X:126206316-126206338 CTTAAGCTAATAAACAACTTCGG - Intergenic
1198757847 X:139999907-139999929 CTTAAGCTGGTAAACAACTTCGG - Intergenic
1199023340 X:142908620-142908642 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1199122403 X:144071112-144071134 CTTAAGCTGATAAGCAACTTTGG - Intergenic
1199386025 X:147224113-147224135 CTTAAGCTGATAAGCAACTTCGG + Intergenic
1199397293 X:147353885-147353907 TTCAAGCTGATAAGCAACTTCGG + Intergenic
1200330234 X:155288118-155288140 CTTCAGCTGATAAACAACTTTGG - Intronic
1200371026 X:155724685-155724707 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1200471428 Y:3590926-3590948 CTTAAGCTGATAAGCGACTTCGG - Intergenic
1201167698 Y:11225187-11225209 CTTAAGCTGATAAGCAACTTCGG - Intergenic
1201389800 Y:13485287-13485309 CTTAAGCTCATAAGCAACTTCGG - Intergenic
1201390794 Y:13495182-13495204 CTTAAGCTCACAAGCAACTTTGG + Intergenic
1201929453 Y:19326335-19326357 CTTAGACTGATAAGCAATTTTGG + Intergenic
1201976428 Y:19854238-19854260 CCTTAGCTGATAAGCAACTTTGG + Intergenic
1202331727 Y:23760534-23760556 CTTAAGATGATAGGCAACTTCGG + Intergenic
1202539043 Y:25909526-25909548 CTTAAGATGATAGGCAACTTCGG - Intergenic