ID: 930987289

View in Genome Browser
Species Human (GRCh38)
Location 2:57605799-57605821
Sequence CAAAGTTGCTTATCAGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17875
Summary {0: 24, 1: 296, 2: 10488, 3: 5081, 4: 1986}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987286_930987289 -10 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987289 2:57605799-57605821 CAAAGTTGCTTATCAGCTTAAGG 0: 24
1: 296
2: 10488
3: 5081
4: 1986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987289 Original CRISPR CAAAGTTGCTTATCAGCTTA AGG Intergenic
Too many off-targets to display for this crispr