ID: 930987290

View in Genome Browser
Species Human (GRCh38)
Location 2:57605808-57605830
Sequence TTATCAGCTTAAGGAGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20599
Summary {0: 558, 1: 10672, 2: 5569, 3: 2403, 4: 1397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987286_930987290 -1 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987290 2:57605808-57605830 TTATCAGCTTAAGGAGTTTTTGG 0: 558
1: 10672
2: 5569
3: 2403
4: 1397
930987287_930987290 -8 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987290 2:57605808-57605830 TTATCAGCTTAAGGAGTTTTTGG 0: 558
1: 10672
2: 5569
3: 2403
4: 1397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987290 Original CRISPR TTATCAGCTTAAGGAGTTTT TGG Intergenic
Too many off-targets to display for this crispr