ID: 930987291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:57605809-57605831 |
| Sequence | TATCAGCTTAAGGAGTTTTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 20758 | |||
| Summary | {0: 329, 1: 10618, 2: 5358, 3: 2499, 4: 1954} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930987286_930987291 | 0 | Left | 930987286 | 2:57605786-57605808 | CCTAAGACCTTGCCAAAGTTGCT | No data | ||
| Right | 930987291 | 2:57605809-57605831 | TATCAGCTTAAGGAGTTTTTGGG | 0: 329 1: 10618 2: 5358 3: 2499 4: 1954 |
||||
| 930987287_930987291 | -7 | Left | 930987287 | 2:57605793-57605815 | CCTTGCCAAAGTTGCTTATCAGC | No data | ||
| Right | 930987291 | 2:57605809-57605831 | TATCAGCTTAAGGAGTTTTTGGG | 0: 329 1: 10618 2: 5358 3: 2499 4: 1954 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930987291 | Original CRISPR | TATCAGCTTAAGGAGTTTTT GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||