ID: 930987291

View in Genome Browser
Species Human (GRCh38)
Location 2:57605809-57605831
Sequence TATCAGCTTAAGGAGTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20758
Summary {0: 329, 1: 10618, 2: 5358, 3: 2499, 4: 1954}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987286_930987291 0 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987291 2:57605809-57605831 TATCAGCTTAAGGAGTTTTTGGG 0: 329
1: 10618
2: 5358
3: 2499
4: 1954
930987287_930987291 -7 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987291 2:57605809-57605831 TATCAGCTTAAGGAGTTTTTGGG 0: 329
1: 10618
2: 5358
3: 2499
4: 1954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987291 Original CRISPR TATCAGCTTAAGGAGTTTTT GGG Intergenic
Too many off-targets to display for this crispr