ID: 930987292

View in Genome Browser
Species Human (GRCh38)
Location 2:57605821-57605843
Sequence GAGTTTTTGGGCTGAGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930987286_930987292 12 Left 930987286 2:57605786-57605808 CCTAAGACCTTGCCAAAGTTGCT No data
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data
930987288_930987292 0 Left 930987288 2:57605798-57605820 CCAAAGTTGCTTATCAGCTTAAG 0: 111
1: 101
2: 59
3: 50
4: 130
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data
930987287_930987292 5 Left 930987287 2:57605793-57605815 CCTTGCCAAAGTTGCTTATCAGC No data
Right 930987292 2:57605821-57605843 GAGTTTTTGGGCTGAGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930987292 Original CRISPR GAGTTTTTGGGCTGAGACGT TGG Intergenic
No off target data available for this crispr