ID: 930990933

View in Genome Browser
Species Human (GRCh38)
Location 2:57653617-57653639
Sequence CATAGAGACCAGAAGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930990933_930990937 -10 Left 930990933 2:57653617-57653639 CCCACTACCTTCTGGTCTCTATG No data
Right 930990937 2:57653630-57653652 GGTCTCTATGGTAGCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930990933 Original CRISPR CATAGAGACCAGAAGGTAGT GGG (reversed) Intergenic
No off target data available for this crispr