ID: 930993224

View in Genome Browser
Species Human (GRCh38)
Location 2:57685449-57685471
Sequence CTCAGGTGGTATGGGAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930993224_930993230 -9 Left 930993224 2:57685449-57685471 CCACTACTCCCATACCACCTGAG No data
Right 930993230 2:57685463-57685485 CCACCTGAGTTTTTGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930993224 Original CRISPR CTCAGGTGGTATGGGAGTAG TGG (reversed) Intergenic
No off target data available for this crispr