ID: 930999137

View in Genome Browser
Species Human (GRCh38)
Location 2:57760138-57760160
Sequence GTGGACAAAAGGCCCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930999137_930999150 22 Left 930999137 2:57760138-57760160 CCCTCCTCGGGCCTTTTGTCCAC No data
Right 930999150 2:57760183-57760205 TACAAGGCGAGGAGACAAAAGGG No data
930999137_930999142 6 Left 930999137 2:57760138-57760160 CCCTCCTCGGGCCTTTTGTCCAC No data
Right 930999142 2:57760167-57760189 TCCATCCTCCAGCCCATACAAGG No data
930999137_930999145 11 Left 930999137 2:57760138-57760160 CCCTCCTCGGGCCTTTTGTCCAC No data
Right 930999145 2:57760172-57760194 CCTCCAGCCCATACAAGGCGAGG No data
930999137_930999149 21 Left 930999137 2:57760138-57760160 CCCTCCTCGGGCCTTTTGTCCAC No data
Right 930999149 2:57760182-57760204 ATACAAGGCGAGGAGACAAAAGG No data
930999137_930999151 23 Left 930999137 2:57760138-57760160 CCCTCCTCGGGCCTTTTGTCCAC No data
Right 930999151 2:57760184-57760206 ACAAGGCGAGGAGACAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930999137 Original CRISPR GTGGACAAAAGGCCCGAGGA GGG (reversed) Intergenic
No off target data available for this crispr