ID: 931005465

View in Genome Browser
Species Human (GRCh38)
Location 2:57846345-57846367
Sequence TGGGCCCATAGGGGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931005465_931005475 5 Left 931005465 2:57846345-57846367 CCAGGCCAACCCCTATGGGCCCA No data
Right 931005475 2:57846373-57846395 CAGGCTGGCCTCTCGAGCACAGG No data
931005465_931005471 -10 Left 931005465 2:57846345-57846367 CCAGGCCAACCCCTATGGGCCCA No data
Right 931005471 2:57846358-57846380 TATGGGCCCATACTCCAGGCTGG No data
931005465_931005476 12 Left 931005465 2:57846345-57846367 CCAGGCCAACCCCTATGGGCCCA No data
Right 931005476 2:57846380-57846402 GCCTCTCGAGCACAGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931005465 Original CRISPR TGGGCCCATAGGGGTTGGCC TGG (reversed) Intergenic