ID: 931005465 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:57846345-57846367 |
Sequence | TGGGCCCATAGGGGTTGGCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931005465_931005475 | 5 | Left | 931005465 | 2:57846345-57846367 | CCAGGCCAACCCCTATGGGCCCA | No data | ||
Right | 931005475 | 2:57846373-57846395 | CAGGCTGGCCTCTCGAGCACAGG | No data | ||||
931005465_931005471 | -10 | Left | 931005465 | 2:57846345-57846367 | CCAGGCCAACCCCTATGGGCCCA | No data | ||
Right | 931005471 | 2:57846358-57846380 | TATGGGCCCATACTCCAGGCTGG | No data | ||||
931005465_931005476 | 12 | Left | 931005465 | 2:57846345-57846367 | CCAGGCCAACCCCTATGGGCCCA | No data | ||
Right | 931005476 | 2:57846380-57846402 | GCCTCTCGAGCACAGGCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931005465 | Original CRISPR | TGGGCCCATAGGGGTTGGCC TGG (reversed) | Intergenic | ||