ID: 931010181

View in Genome Browser
Species Human (GRCh38)
Location 2:57902822-57902844
Sequence TTGAGGAATGGAATGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931010177_931010181 -7 Left 931010177 2:57902806-57902828 CCTTCTTAGTCATGTGTTGAGGA No data
Right 931010181 2:57902822-57902844 TTGAGGAATGGAATGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931010181 Original CRISPR TTGAGGAATGGAATGGTGAA GGG Intergenic
No off target data available for this crispr