ID: 931010655

View in Genome Browser
Species Human (GRCh38)
Location 2:57908933-57908955
Sequence AGGTTTTGGCTACTTTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931010655_931010658 1 Left 931010655 2:57908933-57908955 CCAATCAAAAGTAGCCAAAACCT 0: 1
1: 0
2: 2
3: 15
4: 231
Right 931010658 2:57908957-57908979 AGAAAATTATTAATATAATTAGG 0: 1
1: 1
2: 11
3: 138
4: 1402
931010655_931010660 15 Left 931010655 2:57908933-57908955 CCAATCAAAAGTAGCCAAAACCT 0: 1
1: 0
2: 2
3: 15
4: 231
Right 931010660 2:57908971-57908993 ATAATTAGGGACGTTCCAATAGG 0: 1
1: 0
2: 4
3: 15
4: 63
931010655_931010662 30 Left 931010655 2:57908933-57908955 CCAATCAAAAGTAGCCAAAACCT 0: 1
1: 0
2: 2
3: 15
4: 231
Right 931010662 2:57908986-57909008 CCAATAGGATATACCAAATAAGG 0: 1
1: 2
2: 8
3: 29
4: 160
931010655_931010659 2 Left 931010655 2:57908933-57908955 CCAATCAAAAGTAGCCAAAACCT 0: 1
1: 0
2: 2
3: 15
4: 231
Right 931010659 2:57908958-57908980 GAAAATTATTAATATAATTAGGG 0: 1
1: 0
2: 10
3: 114
4: 1138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931010655 Original CRISPR AGGTTTTGGCTACTTTTGAT TGG (reversed) Intronic
904244618 1:29178312-29178334 AGATTTTGGATGCTTTAGATAGG - Intronic
905688090 1:39923205-39923227 AGATTTTGGCTTCTTTTGAAGGG + Intergenic
905719827 1:40188109-40188131 AGGTTTTGCCTATTCTTAATTGG - Intronic
907275815 1:53316100-53316122 AGGTTTCTGCTACTTTACATAGG + Intronic
908353640 1:63310640-63310662 AGGGTTTGGCCACCTCTGATAGG - Intergenic
910003283 1:82362718-82362740 AGATTTTGGGTACTTTTTAAAGG - Intergenic
911618886 1:100044367-100044389 GTCTTTTGCCTACTTTTGATGGG + Intronic
912792543 1:112666411-112666433 AAGTTTTGGCAACTTAAGATAGG - Intronic
913647935 1:120878908-120878930 AGCATTTGTCTACTTTTAATAGG + Intergenic
914078693 1:144383931-144383953 AGCATTTGTCTACTTTTAATAGG - Intergenic
914100486 1:144582571-144582593 AGCATTTGTCTACTTTTAATAGG + Intergenic
914173600 1:145252479-145252501 AGCATTTGTCTACTTTTAATAGG - Intergenic
914298498 1:146355082-146355104 AGCATTTGTCTACTTTTAATAGG - Intergenic
914528254 1:148493620-148493642 AGCATTTGTCTACTTTTAATAGG - Intergenic
914638132 1:149573447-149573469 AGCATTTGTCTACTTTTAATAGG + Intergenic
916100031 1:161386757-161386779 AGTTTTTGGCTACTTCCAATTGG - Intergenic
917171958 1:172186553-172186575 AAGTTTTGGTTATTTTTGAGAGG + Intronic
917345452 1:174023743-174023765 AGGTTTTAGCGACTGTTGCTAGG + Intergenic
917909901 1:179632815-179632837 ATGTATTGTCTACTTATGATGGG - Intronic
918760711 1:188402125-188402147 ATATTTTGACTACTTTTTATTGG - Intergenic
919374198 1:196771632-196771654 AGGTTTTGGGCTTTTTTGATGGG + Intergenic
920319088 1:205103896-205103918 ACGTTGTGGCATCTTTTGATAGG - Exonic
920805511 1:209230496-209230518 AGGTTATGGCTGGTTCTGATAGG + Intergenic
921772814 1:219062213-219062235 AAGAGTTGGCTACATTTGATTGG - Intergenic
921901309 1:220453976-220453998 AGTTTTTGTCTACTTGTGACTGG + Intergenic
922521013 1:226252342-226252364 TGGTTTTGTGTTCTTTTGATAGG - Intronic
1066935629 10:41829267-41829289 AGCTTCTGTCTAGTTTTGATGGG + Intergenic
1070600149 10:77860280-77860302 AGGTTTTGGGTTTTTTTGGTTGG + Intronic
1070636594 10:78133615-78133637 AAGATTTGGCTACTTTGGGTGGG + Intergenic
1071428507 10:85583311-85583333 AGATTTTGACTACTTCTGATAGG - Intergenic
1075857279 10:125640555-125640577 ATGTTTTGGTTTGTTTTGATGGG + Intronic
1077592529 11:3503694-3503716 AGATGTTGGTTACTTTTGGTAGG + Intergenic
1078621927 11:12915983-12916005 AGAATTTGGAAACTTTTGATGGG + Intronic
1080906482 11:36550917-36550939 AGGAATTGGGAACTTTTGATTGG + Intronic
1080940470 11:36912332-36912354 AGGTGTTGGCTATGGTTGATTGG + Intergenic
1081496172 11:43612800-43612822 AGTATGTGGCTACTTTAGATAGG + Intronic
1081814806 11:45932846-45932868 AGGTCTTGGCTACCCTTAATTGG + Intronic
1084248364 11:67876417-67876439 AGATGTTGGTTACTTTTGGTAGG + Intergenic
1084824456 11:71719064-71719086 AGATGTTGGTTACTTTTGGTAGG - Intergenic
1087503244 11:98986858-98986880 ATATTTTGACCACTTTTGATTGG - Intergenic
1089072638 11:115712060-115712082 AGGTGTGTGCTACTTTGGATTGG + Intergenic
1092418647 12:8311814-8311836 AGATGTTGGTTACTTTTGGTAGG + Intergenic
1093684865 12:22044692-22044714 AGGTCTTGGCCATTTTTGAGGGG - Intergenic
1094380256 12:29834785-29834807 ATCTTTTGCCTAGTTTTGATTGG + Intergenic
1094586121 12:31778866-31778888 AACATTTGGCTACATTTGATTGG + Intergenic
1095580134 12:43788187-43788209 AGGTTTTGCCCACATTTGAGGGG + Intronic
1096228775 12:49885956-49885978 AGGTTTTGGGGGCTTTGGATAGG - Intronic
1098099486 12:66999024-66999046 AGGTGTGGGCAGCTTTTGATGGG - Intergenic
1098317139 12:69204717-69204739 AGGCTTTGAATAATTTTGATAGG - Intergenic
1098433728 12:70447730-70447752 AGGTTATGCCTACTTTTTAATGG + Intergenic
1098513035 12:71341504-71341526 AGGTTTTGTATGGTTTTGATTGG - Intronic
1098706032 12:73690958-73690980 ATCTTTTGCCTATTTTTGATTGG - Intergenic
1103433225 12:120905032-120905054 AGGTGTGGGTTACTTTAGATAGG + Intergenic
1104248502 12:127066182-127066204 AGGTGTTTGGTACTTTAGATGGG + Intergenic
1105077036 13:16043741-16043763 AGCTTCTGCCTACTTTTTATGGG - Intergenic
1105155201 13:17338080-17338102 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1106234287 13:27848630-27848652 AGGGTTTGGATATTTTTAATTGG - Intergenic
1106644636 13:31618902-31618924 AGGTTTTTAATACTTTTAATGGG + Intergenic
1106729148 13:32521041-32521063 AGGTTTTAGCAATTTTTGAAAGG - Intronic
1109131485 13:58592011-58592033 AACTGTTGTCTACTTTTGATGGG + Intergenic
1109318167 13:60776796-60776818 TGTTTTTGCCTACTTTTAATGGG + Intergenic
1110402338 13:75107720-75107742 AGTTTTTGGCCATTTTTGATTGG - Intergenic
1111421492 13:88017862-88017884 AGGCTTTTGCTGCTTTTGCTTGG + Intergenic
1112374773 13:98829181-98829203 AAGTTTTGCATACTTTTAATTGG + Intronic
1112566682 13:100557878-100557900 TTGTTTTGCCTACTTTTAATTGG - Intronic
1114907538 14:27149511-27149533 ATATTTTGCCTATTTTTGATTGG + Intergenic
1116124133 14:40759381-40759403 AGGCTTTTACTTCTTTTGATAGG + Intergenic
1117627061 14:57650981-57651003 AGGGCTTAGCTACTTTAGATAGG - Intronic
1120456514 14:84737987-84738009 GGTTGTTGGCTACTTCTGATTGG - Intergenic
1122035283 14:98944655-98944677 AGGTGTTGAGTACTTGTGATGGG - Intergenic
1123226808 15:17045506-17045528 AGCTTCTGCCTACTTTTTATGGG - Intergenic
1125613522 15:40989470-40989492 TGGATTTGGTGACTTTTGATTGG - Intronic
1131705678 15:94993185-94993207 AGGTGGTGGCCACTTTTCATGGG - Intergenic
1133358082 16:5151666-5151688 AGATGTTGGTTACTTTTGGTAGG + Intergenic
1133542994 16:6774221-6774243 TGGTTTTGTCTACATTTGAAAGG + Intronic
1133840989 16:9409087-9409109 TGGTTGTGGATACTTTTGTTAGG + Intergenic
1136699877 16:32124195-32124217 AGGTTTTGTCTTGTTTTGTTTGG + Intergenic
1136767777 16:32803292-32803314 AGGTTTTGTCTTGTTTTGTTTGG - Intergenic
1136800372 16:33067405-33067427 AGGTTTTGTCTTGTTTTGTTTGG + Intergenic
1139056232 16:63188451-63188473 AGATTTGGGCTATTTTTGACTGG + Intergenic
1139176322 16:64692919-64692941 AGGTCATTGCTACTTTTGAAAGG - Intergenic
1203070168 16_KI270728v1_random:1065314-1065336 AGGTTTTGTCTTGTTTTGTTTGG - Intergenic
1148639253 17:49173314-49173336 AGGTATTGACTGCTTTTAATAGG - Intergenic
1149536144 17:57435142-57435164 AACTTGGGGCTACTTTTGATGGG + Intronic
1149589091 17:57814680-57814702 TAATTTTGGCTAATTTTGATAGG + Intergenic
1150349504 17:64431851-64431873 TGGTTTTGGCAAGTTTTGATTGG + Intergenic
1151094700 17:71483270-71483292 AAGTTTTGGCTACTTGAAATTGG + Intergenic
1151624341 17:75267337-75267359 AGGTTTTGGCTGCTCTCTATTGG + Intronic
1153268101 18:3291698-3291720 TTGTTGTGGCTATTTTTGATAGG + Intergenic
1154546075 18:15609848-15609870 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154547239 18:15626860-15626882 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154547471 18:15630262-15630284 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154550381 18:15672812-15672834 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154550850 18:15679618-15679640 TGCTTCTGTCTACTTTTGATGGG - Intergenic
1154552240 18:15700034-15700056 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154552816 18:15708539-15708561 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154552929 18:15710240-15710262 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154553401 18:15717046-15717068 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1154557003 18:15769306-15769328 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1157071539 18:44414701-44414723 ATATTTTGCCCACTTTTGATGGG - Intergenic
1157344420 18:46811734-46811756 GGGATTTGGCTACTCTTCATTGG - Exonic
1158069984 18:53459374-53459396 AGGTCTTGGCAACTTTGGATGGG - Exonic
1159633279 18:70774715-70774737 ACTTTTTAGCTACTTTTCATAGG - Intergenic
1163866925 19:19781283-19781305 GGTTGTTGGCTACTTCTGATTGG + Intergenic
1163894697 19:20048118-20048140 GGTTGTTGGCTACTTCTGATTGG - Intergenic
1164356454 19:27438356-27438378 AGCTTCTGTCTAGTTTTGATGGG - Intergenic
1164820685 19:31248957-31248979 AGGTTTTGAGTAGTTTTGAGTGG + Intergenic
1165731243 19:38146740-38146762 TCATTTTAGCTACTTTTGATAGG + Intronic
1166637881 19:44467958-44467980 AGGATGTGGCTCCTTGTGATGGG + Intergenic
926114257 2:10202166-10202188 AGGTTTGGGCTAGTTGTGAAAGG - Intronic
927471062 2:23377162-23377184 AAGTTTTGGGTAAATTTGATAGG + Intergenic
927481333 2:23456608-23456630 GGGTTCTGGCTACTTGTGCTTGG + Intronic
928382742 2:30834124-30834146 AGCAGTTGGCTACATTTGATTGG - Intergenic
929885287 2:45872616-45872638 AGGTTTTGGATATATTTGAGCGG + Intronic
930661662 2:54060824-54060846 AGATTTTAGCTTCTTTTGCTTGG + Intronic
931010655 2:57908933-57908955 AGGTTTTGGCTACTTTTGATTGG - Intronic
931737955 2:65215049-65215071 GGGGTTTGACTACTTTTGTTAGG + Intergenic
932078123 2:68685612-68685634 AGGCTTTTGCTACTTTTTATTGG - Intronic
936808310 2:116364150-116364172 ATGTTTAGCCTACTTTTAATTGG - Intergenic
939584278 2:143987934-143987956 AGGTTATCGATACTCTTGATTGG + Intronic
940094889 2:149962973-149962995 CTGTTTTGGATATTTTTGATGGG + Intergenic
940139884 2:150482621-150482643 AGGTTTTGTTTACTTTTGTTGGG + Intronic
940970851 2:159894938-159894960 AGGTTTTGGCAAATTGTGACAGG - Intronic
942797077 2:179834261-179834283 AGGTTCTGGCTTCTTCTAATGGG - Intronic
943966376 2:194339099-194339121 AGGATTTGGCTGCTATGGATAGG + Intergenic
944842896 2:203641431-203641453 ATATTTTGCCTATTTTTGATTGG + Intergenic
947405507 2:229772103-229772125 AGGCTTTGCCTACTTTTAGTAGG - Intronic
948947082 2:241226189-241226211 AGGTGGTGGCTACTCTGGATGGG - Intergenic
1174074982 20:47928192-47928214 ACCTGTTGGCTACTTCTGATTGG - Intergenic
1174129981 20:48337122-48337144 ATCTTTTGCCTGCTTTTGATGGG - Intergenic
1175390859 20:58626479-58626501 GGGTATTGGCTATTTCTGATTGG + Intergenic
1176693191 21:9943057-9943079 GTGTGTTGGCTACTTCTGATTGG + Intergenic
1177595683 21:23239362-23239384 ACCTTTTGGGTACTGTTGATTGG - Intergenic
1178934706 21:36851244-36851266 AGGTCTTGGCTACTGTGAATAGG - Intronic
1183002612 22:34874303-34874325 AAGTAGTGGCTACTTTAGATTGG + Intergenic
949791284 3:7794616-7794638 AAGTTTTGGTTACATTTAATAGG - Intergenic
950792530 3:15484831-15484853 AGGTTTTAGCTTCTTTAGCTCGG + Intronic
951038682 3:17964061-17964083 CTGTTTTGGCTACATTTAATGGG + Intronic
951740409 3:25915734-25915756 AGATTTTGGCTATTATTAATAGG + Intergenic
952811123 3:37404084-37404106 ATGTTTTGGCCATTTTTAATTGG + Intronic
953115504 3:39988927-39988949 GGGTTTTGGCTTCTTTGCATTGG + Intronic
953643997 3:44736796-44736818 AGGTTTTGCCCATTTTTAATTGG + Exonic
957159127 3:76585632-76585654 ATGTTTTGGTTAATTTTGTTAGG - Intronic
957692479 3:83590079-83590101 AGGTTTTTACTACTTAGGATTGG + Intergenic
957878637 3:86182227-86182249 AGTTTATGGCTACTTTTTATGGG - Intergenic
958815062 3:98905285-98905307 AGGTTCTGGCTTCTTTTTACAGG + Intergenic
958815975 3:98916030-98916052 AGGTTTTGTCCAATTTTCATGGG - Intergenic
958866902 3:99511244-99511266 ATCTTTTGCCTACTTTTTATTGG + Intergenic
959583271 3:108003368-108003390 TGGTTCTGGCTACTTTTTCTGGG - Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
961896324 3:130171040-130171062 AGATGTTGGTTACTTTTGGTAGG + Intergenic
963559885 3:146850982-146851004 AGTTTATGGCTGTTTTTGATGGG - Intergenic
964085139 3:152808072-152808094 TGGTTTTGACTACCTTTGTTGGG - Intergenic
966649696 3:182285882-182285904 AGGTTTGGGTTACTCTTTATAGG - Intergenic
967475210 3:189908607-189908629 AGGTATTTGCTAACTTTGATGGG - Intergenic
967539858 3:190654529-190654551 AAGTTTTGAGAACTTTTGATTGG - Intronic
969006502 4:4024384-4024406 AGATGTTGGTTACTTTTGGTAGG + Intergenic
969806463 4:9612918-9612940 AGATGTTGGTTACTTTTGGTAGG - Intergenic
969855823 4:9998875-9998897 TGTTTTTGGCTGCTTTTGGTTGG - Intronic
970855806 4:20648593-20648615 AGGGATTGGGGACTTTTGATCGG + Intergenic
971778987 4:31006091-31006113 AAATTTTGGCTACTGTTGTTAGG + Intronic
972131905 4:35847526-35847548 ATGTTTTGGAGACTTTTCATAGG + Intergenic
973217974 4:47692692-47692714 AGGCTTTGGTTTATTTTGATTGG - Intronic
973271251 4:48265291-48265313 AGATATTGGCTATTTTTGACTGG - Intronic
975487147 4:74946661-74946683 TGGTTTTGAGTCCTTTTGATGGG - Intronic
978130486 4:105190259-105190281 AGGTTTTGGATACCTATAATTGG - Intronic
978294746 4:107191858-107191880 AGCAGTTGGCTACATTTGATTGG + Intronic
980365799 4:131803276-131803298 GTGTGTTGGCTACTTCTGATTGG + Intergenic
982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG + Intergenic
983277362 4:165635034-165635056 TGGTTTTGGCAACTGCTGATTGG + Intergenic
984181937 4:176494488-176494510 AAGGGTTGGCTACATTTGATTGG - Intergenic
986121018 5:4836752-4836774 AGGCTTTTGCTACTATTGTTAGG - Intergenic
986124030 5:4868750-4868772 AAGAGTTGGCTACATTTGATTGG - Intergenic
987244940 5:16039221-16039243 AGGTTTTGGGCACTTTTGGTAGG - Intergenic
987256587 5:16160025-16160047 GTGTTTTGGCTTCTTTTGTTTGG - Intronic
990242087 5:53826007-53826029 AGGATTTGTCTTCTTGTGATTGG - Intergenic
990289814 5:54338377-54338399 ATGTTTTGGTTACTTTAGCTAGG - Intergenic
992358747 5:76013633-76013655 ATGTTTAGGGTACTTTTCATTGG - Intergenic
993800150 5:92322880-92322902 ACGTTTTGCCCACTTTTAATTGG - Intergenic
995300662 5:110577193-110577215 ATCTTTTGCCTACTTTTTATGGG - Intronic
995588836 5:113677103-113677125 AGGTTTAGGCTTCATTTCATAGG + Intergenic
996801118 5:127404286-127404308 ATCTTTTGCCTATTTTTGATTGG + Intronic
997279980 5:132635832-132635854 ATGTTTTGTCTCCTTTTGAAAGG + Intronic
998606555 5:143641176-143641198 AGGTTTTTGCAACATTTAATAGG + Intergenic
1000105538 5:158055475-158055497 AGGGAGTGGCTACGTTTGATGGG + Intergenic
1000549378 5:162640710-162640732 ATTTTTTGCCTATTTTTGATTGG + Intergenic
1003050930 6:2780806-2780828 AGGATTTGCCTTGTTTTGATTGG + Intronic
1003603118 6:7536506-7536528 AGTTTTTGACTGCTTTTCATTGG - Intergenic
1004901548 6:20199007-20199029 AACATTTGGCTACATTTGATTGG - Intronic
1008443958 6:51566347-51566369 AGCTTTCTGCTCCTTTTGATGGG - Intergenic
1009793798 6:68439552-68439574 TGGTTTTGGCTAGTTTTTGTTGG - Intergenic
1009824523 6:68848803-68848825 AGGTTTTGTTAAATTTTGATAGG - Intronic
1010854296 6:80818256-80818278 CGGTTTTGCCTATTTTTAATGGG + Intergenic
1014281140 6:119443596-119443618 AGGTTTTGCCTTTTTTTGGTAGG - Intergenic
1014411629 6:121130139-121130161 AGTTTTTGGTTCCTTTTTATGGG - Intronic
1016011961 6:139146555-139146577 AAGTTCTGGCTATTTTTGATTGG + Intronic
1016174299 6:141059831-141059853 GGTTTATGGCTACTCTTGATGGG - Intergenic
1018848858 6:167573394-167573416 CGGTTTTGTCAACTCTTGATTGG + Intergenic
1019847923 7:3525180-3525202 AGGTTTTGGGTATTCTTGGTGGG + Intronic
1020327033 7:6982676-6982698 AGATGTTGGTTACTTTTGGTAGG + Intergenic
1020640542 7:10748311-10748333 AGGTTTTAGCTTCTTTTGATGGG - Intergenic
1020756474 7:12210193-12210215 AGGTTTAGGATACTTCTGAAAGG + Intergenic
1024322740 7:48086937-48086959 AGGTTTTGGCCAGTTTTGGCTGG - Intergenic
1025822452 7:64980851-64980873 AGGATTTGGCTATTTTGGATTGG - Intronic
1027801101 7:82750101-82750123 TGGGTTTGGCAACTTATGATTGG - Intergenic
1028028178 7:85873288-85873310 AGTTTTTGGCTACTTTTAATTGG + Intergenic
1028671062 7:93400465-93400487 GGGTCCTGACTACTTTTGATAGG + Intergenic
1030852620 7:114509524-114509546 AGGTTTTGTTAATTTTTGATAGG + Intronic
1032519495 7:132533321-132533343 AGGATTTGGCTACCTATGATGGG - Intronic
1034140269 7:148808969-148808991 AGTTCTTTGCTTCTTTTGATGGG - Intronic
1034293931 7:149954894-149954916 AAGGTTTAGCTCCTTTTGATTGG + Intergenic
1034812139 7:154141966-154141988 AAGGTTTAGCTCCTTTTGATTGG - Intronic
1036369601 8:8151411-8151433 AGATGTTGGTTACTTTTGGTAGG - Intergenic
1038253480 8:25928048-25928070 AAGTTTTGGCTACCTTTGTGTGG - Intronic
1041582529 8:59478013-59478035 AGATTTTGGTTACATTTGAGTGG + Intergenic
1041969734 8:63725965-63725987 AGGTTTTAGCTACTTCTCATTGG - Intergenic
1042366049 8:67938059-67938081 ATCTTTTGTCCACTTTTGATGGG + Intergenic
1044654965 8:94538523-94538545 AGCTGTTGGCTACTTGAGATTGG - Intronic
1046441150 8:114255813-114255835 AGATTTTGGAAACTTTTGTTTGG - Intergenic
1047134274 8:122057781-122057803 GTTTTTTGGCTACTTTTGGTAGG - Intergenic
1048466440 8:134668192-134668214 AGGTTTCTGCTGCTTTTGTTCGG - Intronic
1048918212 8:139204012-139204034 AGTCTTTGGCTACTTGAGATGGG - Intergenic
1052055243 9:23898610-23898632 AAGAGTTGGCTACCTTTGATTGG + Intergenic
1052328889 9:27247002-27247024 AGGTTCTTTCTACATTTGATTGG - Intergenic
1052605997 9:30701498-30701520 AGCATTTGGCCACATTTGATTGG - Intergenic
1052889208 9:33681801-33681823 TGGTTTTGACTTCTTTTGGTAGG - Intergenic
1053630149 9:39929145-39929167 GTGTGTTGGCTACTTCTGATTGG + Intergenic
1053775623 9:41534387-41534409 GTGTGTTGGCTACTTCTGATTGG - Intergenic
1054213738 9:62321557-62321579 GTGTGTTGGCTACTTCTGATTGG - Intergenic
1054957618 9:70930801-70930823 AGGTTTTGTCTTCTTTTCAATGG - Intronic
1055395730 9:75872988-75873010 ATCTTTTGCCTATTTTTGATTGG - Intergenic
1057277779 9:93685193-93685215 AGGTTTTGTCCACTTGTGAAAGG + Intergenic
1059932972 9:119279579-119279601 AGGCTTTGGCTACCTCTGAAGGG - Intronic
1060363924 9:122989684-122989706 ATCTGTTGGCTACTTTTGATTGG + Intronic
1203401222 Un_KI270519v1:100747-100769 AGCTTCTGCCTACTTTTTATGGG - Intergenic
1188067182 X:25677314-25677336 AGGTTTTGGCCAGTTTTGACTGG + Intergenic
1188067380 X:25678864-25678886 TGGTTTTGGCTGTTTTTGACTGG + Intergenic
1188087548 X:25919488-25919510 ATGTTTTGCCCACTTTTAATGGG - Intergenic
1188094489 X:26004754-26004776 ATGTTTTGCCCATTTTTGATTGG - Intergenic
1188471860 X:30549703-30549725 AGATAATGGTTACTTTTGATGGG - Intergenic
1191109100 X:56791177-56791199 ACGTTTTGTCCACTTTTGTTTGG + Intergenic
1191574291 X:62678947-62678969 AGCTTTTGTCTAGTTTTTATGGG - Intergenic
1191935527 X:66423556-66423578 AGGTTTATGCTCCTTTTGTTTGG + Intergenic
1194116719 X:89909157-89909179 ATGTTTTGCCTATTTTTAATTGG - Intergenic
1195452103 X:105026929-105026951 ATGTTTTGGTTACTATTGCTTGG - Intronic
1195558608 X:106256931-106256953 AAGTGTTGGCTATATTTGATGGG + Intergenic
1198674010 X:139112555-139112577 AGGTCTTGGCAACATTTTATGGG - Intronic
1200469514 Y:3566323-3566345 ATGTTTTGCCTATTTTTAATTGG - Intergenic
1200940945 Y:8781096-8781118 AGGTTTTAGATAATTTTGAAAGG + Intergenic